Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tetraodon nigroviridis (spotted green pufferfish) tni-miR-129 URS00000E0403_99883

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUUUGCGGUCUGGGCUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus (cattle) bta-miR-129
  2. Danio rerio dre-miR-129-5p
  3. Eptesicus fuscus efu-miR-129b
  4. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-129b-5p
  5. Homo sapiens microRNA miR-129
  6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-129-5p
  7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-34300362
  8. Ophiophagus hannah (king cobra) oha-miR-129a-5p
  9. Takifugu rubripes (torafugu) fru-miR-129
  10. Tor tambroides (Thai mahseer) miR-129-5p