Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548e-3p URS00000D2680_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548e: Hsa-mir-548e is a member of the miR-548 family, which is characterized by a larger genetic distance from other members within the family, indicating its unique evolutionary path [PMC3468316]. This miRNA has been observed to decrease significantly in cellular levels when HEK293 cells are exposed to lead sulfide quantum dots (PbS–MPA QDs), suggesting its potential role in cellular response to heavy metal exposure [PMC4560511]. Furthermore, hsa-mir-548e is among the miRNAs proposed as exosomal biomarkers for HEK293 cells' exposure to PbS–MPA QDs [PMC4560511]. In studies of congenital anomalies of the kidney and urinary tract (CAKUT), hsa-mir-548e has been identified as one of the miRNAs affected by rare copy number variations (CNVs), which are significant for understanding gene-miRNA interaction networks in this condition [PMC9587983]. Additionally, hsa-mir-548e has been consistently identified across various miRNA databases, highlighting its potential importance in biological research and clinical diagnostics [PMC4359307]. In liver hepatocellular carcinoma (LIHC) patients with varying tumor mutational burdens (TMB), hsa-mir-548e is among the differentially expressed miRNAs that may be involved in the biological processes associated with this cancer type [PMC7355149].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAACUGAGACUACUUUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications