Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo heidelbergensis (Heidelberg man) tRNA-Gly secondary structure diagram

Homo heidelbergensis (Heidelberg man) tRNA-Gly URS00000C6674_1425170

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCUUUUAGUAUAAAUAGUACCGUUAACUUCCAAUUAACUAGUUUUGACAACAUUCAAAAAAGAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Cloning vector pRS316-1B9 tRNA-Gly
  2. Homo sapiens mitochondrially encoded tRNA-Gly (GGN) (MT-TG)
  3. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Gly
  4. Homo sapiens subsp. 'Denisova' subsp. 'Denisova' (Denisova hominin) transfer RNA-Gly
  5. Pan troglodytes ellioti tRNA-Gly
  6. Pan troglodytes verus tRNA-Gly
2D structure