Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Vigna unguiculata (cowpea) vun-miR156b URS00000BABFD_3917

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGACAGAAGAUAGAGAGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Amborella trichopoda atr-miR156c
  2. Ananas comosus ath-miR157a
  3. Arabidopsis lyrata (lyrate rockcress) aly-miR157c-5p
  4. Arabidopsis thaliana ath-miR157b-5p
  5. Arachis hypogaea (peanut) ahy-miR156b-5p
  6. Asparagus officinalis aof-miR156b
  7. Brassica napus (rape) bna-miR156b
  8. Brassica oleracea (wild cabbage) bol-miR157a
  9. Brassica rapa bra-miR157a
  10. Carica papaya cpa-miR156e
  11. Cucumis melo cme-miR156b
  12. Cynara cardunculus (wild artichoke) cca-miR156c
  13. Fragaria vesca subsp. vesca fve-miR156g-5p
  14. Glycine max gma-miR156l
  15. Gossypium raimondii gra-miR157b
  16. Helianthus annuus han-miR156c
  17. Hypericum perforatum Hyp-miR156a
  18. Linum usitatissimum lus-miR156f
  19. Malus domestica mdm-miR156ac
  20. Manihot esculenta (cassava) mes-miR156j
  21. Medicago truncatula (barrel medic) mtr-miR156h-5p
  22. Nicotiana attenuata microRNA mir-157/156-like
  23. Pachycladon fastigiatum Pfa-miR157c
  24. Populus tomentosa Pto-miR156g
  25. Populus trichocarpa ptc-miR156h
  26. Prunus persica (peach) ppe-miR156i
  27. Ricinus communis (castor bean) rco-miR156h
  28. Rosa chinensis ath-miR157a-5p
  29. Solanum lycopersicum (tomato) sly-miR156c
  30. Solanum tuberosum (potato) stu-miR156b
  31. Theobroma cacao tcc-miR156f
  32. Vitis vinifera vvi-miR156g
  33. Vriesea carinata vca-miR156b-5p
Publications