Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0330892_df_nrg URS00000B33AD_46245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAAUUCCGUAGUGCAUUGCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Aedes aegypti Aae-Mir-932_5p (mature (guide))
  2. Anopheles gambiae aga-miR-932-5p
  3. Bactrocera dorsalis bdo-miR-932
  4. Blattella germanica (German cockroach) Bge-Mir-932_5p (mature (co-guide))
  5. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-932
  6. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-932
  7. Drosophila ananassae Dan-Mir-932_5p (mature (guide))
  8. Drosophila melanogaster (fruit fly) Dme-Mir-932_5p (mature (guide))
  9. Drosophila mojavensis Dmo-Mir-932_5p (mature (guide))
  10. Drosophila pseudoobscura dps-miR-932-5p
  11. Drosophila simulans dsi-miR-932-5p
  12. Drosophila virilis dvi-miR-932-5p
  13. Drosophila yakuba Dya-Mir-932_5p (mature (guide))
  14. Heliconius melpomene hme-miR-932
  15. Manduca sexta mse-miR-932
  16. Spodoptera frugiperda (fall armyworm) sfr-miR-932-5p
  17. Tribolium castaneum (red flour beetle) tca-miR-932-5p