Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nothobranchius furzeri tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3) secondary structure diagram

Nothobranchius furzeri tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3) URS00000A1A88_105023

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGCCGUGGCUUAGUUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 133 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  3. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  4. Albula goreensis tRNA-Thr
  5. Alligator mississippiensis tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  6. Alligator sinensis tRNA
  7. Alosa alosa (allis shad) tRNA-Thr
  8. Amazona aestiva tRNA
  9. Ameiurus melas (black bullhead) tRNA-Thr
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla tRNA-Thr
  12. Anolis carolinensis tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  13. Astyanax mexicanus (Mexican tetra) tRNA
  14. Ataeniobius toweri tRNA-Thr
  15. Balaenoptera acutorostrata scammoni tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  16. Bos taurus tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  17. Callipepla squamata (scaled quail) tRNA
  18. Callithrix jacchus tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  19. Calypte anna (Anna's hummingbird) tRNA
  20. Camelus ferus (Wild Bactrian camel) tRNA
  21. Canis lupus familiaris tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  22. Carlito syrichta tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  23. Cavia porcellus tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1)
  24. Ceratotherium simum simum tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  25. Chaetura pelagica (chimney swift) tRNA
  26. Characodon lateralis tRNA-Thr
  27. Chelonia mydas tRNA
  28. Chelydra serpentina (Common snapping turtle) tRNA-Thr
  29. Chlorocebus sabaeus tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  30. Choloepus hoffmanni tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  31. Chrysemys picta bellii tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  32. Colinus virginianus (northern bobwhite) tRNA
  33. Columba livia partial tRNA-Thr
  34. Corvus brachyrhynchos (American crow) tRNA
  35. Crenichthys baileyi tRNA-Thr
  36. Cricetulus griseus tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  37. Dallia pectoralis tRNA-Thr
  38. Danionella translucida tRNA-Thr
  39. Danio rerio tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 4)
  40. Dasypus novemcinctus tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  41. Dicentrarchus labrax transfer RNA-Thr
  42. Dipodomys ordii tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  43. Echinops telfairi tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1, tRNA-Thr-AGT-2-2)
  44. Eptesicus nilssonii tRNA-Thr
  45. Equus caballus tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1, tRNA-Thr-AGT-2-2)
  46. Erinaceus europaeus tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1, tRNA-Thr-AGT-2-2)
  47. Eschrichtius robustus tRNA-Thr
  48. Felis catus tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  49. Ficedula albicollis tRNA
  50. Fukomys damarensis (Damara mole-rat) tRNA
  51. Gallus gallus tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1)
  52. Gasterosteus aculeatus (three-spined stickleback) tRNA
  53. Geospiza fortis tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  54. Gorilla gorilla gorilla tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  55. Heterocephalus glaber tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1)
  56. Homo sapiens (human) tRNA-Thr (anticodon AGT) 1-1 (TRT-AGT1 1 to 3)
  57. Ictidomys tridecemlineatus tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  58. Lamprotornis superbus tRNA-OTHER
  59. Larimichthys crocea tRNA
  60. Latimeria chalumnae tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 4)
  61. Lepisosteus oculatus tRNA
  62. Lonchura striata domestica tRNA
  63. Loxodonta africana tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1, tRNA-Thr-AGT-2-2)
  64. Macaca mulatta tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-3)
  65. Marmota monax (woodchuck) tRNA.Thr
  66. Megalops atlanticus (tarpon) tRNA-Thr
  67. Meleagris gallopavo tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  68. Melopsittacus undulatus tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  69. Merluccius polli tRNA-Thr
  70. Mesitornis unicolor tRNA
  71. Mesocricetus auratus (golden hamster) tRNA
  72. Microcebus murinus tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  73. Monodelphis domestica tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  74. Mus caroli tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 4)
  75. Mus musculus castaneus tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  76. Mus musculus domesticus tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  77. Mus musculus musculus tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  78. Mus musculus tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  79. Mus pahari tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  80. Mus spretus tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  81. Mustela putorius furo tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  82. Myotis brandtii tRNA
  83. Myotis davidii tRNA
  84. Myotis lucifugus tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  85. Neotoma lepida tRNA
  86. Nomascus leucogenys tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  87. Notamacropus eugenii tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  88. Ochotona princeps tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  89. Ophiophagus hannah (king cobra) tRNA
  90. Opisthocomus hoazin tRNA
  91. Oreochromis niloticus tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 5)
  92. Ornithorhynchus anatinus tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 6)
  93. Oryctolagus cuniculus tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  94. Oryzias latipes tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  95. Otolemur garnettii tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  96. Ovis aries tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  97. Pangasianodon gigas (Mekong giant catfish) tRNA-Thr
  98. Pangasianodon hypophthalmus tRNA-Thr
  99. Pangasius djambal tRNA-Thr
  100. Pan troglodytes tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  101. Papio anubis tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 4)
  102. Patagioenas fasciata monilis tRNA
  103. Pelecanus crispus tRNA
  104. Pelobates cultripes (western spadefoot toad) tRNA.Thr
  105. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  106. Perca flavescens tRNA-Thr
  107. Perca fluviatilis tRNA-Thr
  108. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  109. Podarcis lilfordi tRNA.Thr
  110. Poecilia formosa tRNA
  111. Pongo abelii tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  112. Procavia capensis tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  113. Pterocles gutturalis tRNA
  114. Pteropus alecto tRNA
  115. Rattus norvegicus tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  116. Saccoglossus kowalevskii (Acorn worm) tRNA-Thr
  117. Saimiri boliviensis boliviensis tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  118. Sarcophilus harrisii tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1, tRNA-Thr-AGT-2-2)
  119. Scleropages formosus (Asian bonytongue) tRNA
  120. Sorex araneus tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1, tRNA-Thr-AGT-2-2)
  121. Sphaerodactylus townsendi tRNA-Thr
  122. Sus scrofa tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  123. Taeniopygia guttata tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  124. Takifugu rubripes tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 3)
  125. Tetraodon nigroviridis tRNA
  126. Tinamus guttatus tRNA
  127. Trichechus manatus latirostris tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1, tRNA-Thr-AGT-1-2)
  128. Tupaia chinensis (Chinese tree shrew) tRNA
  129. Tursiops truncatus tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  130. Vicugna pacos tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 3)
  131. Xenopus laevis tRNA
  132. Xenopus tropicalis tRNA-Thr (AGT) (tRNA-Thr-AGT-1-1)
  133. Xiphophorus maculatus tRNA
2D structure Publications