v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 114 (LINC00114) URS000009D511_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00114: LINC00114, a long non-coding RNA (lncRNA), has been associated with improved overall survival (OS) in colon cancer patients [PMC8036122]. In a study analyzing colorectal adenocarcinoma (COAD) patients, LINC00114 was identified as one of the differentially expressed lncRNAs, along with a differentially expressed microRNA (hsa-mir-216a) and five differentially expressed mRNAs [PMC9277212]. LINC00114 has been found to be up-regulated in both colorectal cancer (CRC) and nasopharyngeal carcinoma (NPC) [PMC9006613]. Additionally, the predicted miR-133b binding site of LINC00114 was mutated and synthesized chemically for further investigation [PMC6928983]. In experiments conducted on endometrial cancer (EC), it was observed that LINC00114 was up-regulated in both EC tissues and cells. Silencing of LINC00114 resulted in the repression of proliferation, migration, invasion, glycolysis, and induction of apoptosis in EC cells in vitro. Furthermore, it led to the suppression of tumor formation in vivo [PMC9006613].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GACAUGGGACCAACAUAGCUGCCAUGAUGAUCCAGAGACUCCUGCCCUGCAGUUGCCGAUUAAGGUCUGAGAAGUCCUAUAGUCAAGAGACCUACUUAAUUUCUAUAAACUCCAUAUUGCCAAACCUUUAUGUAAUAAGUUUUGAUACCUCUCAAAACUUCUGCAGUCUACACUUGUGGAAACACUAUCGUUUCAUAAACCCAGCAAUUCAAUGUAAAUUUAUCAUUGGCUUCCCUAAAGUAAUUGCUUGGGAGCUCUUGUGCUUGGAGAGUUUGGAAACACAUUAGUCUUUUGCAGAAACGAGUUAGGGCAGCUGGGGAAGAUGACCCUGUUUUCCCUCCCUUCUCUACUUCUUCCUCAAAUGACUGGUAUCUCGAAUUUGCAUAACGGAGGCCAAAAGGUUUUGUGCUACAAUAAAAGAUAAGACUUGAAGAACAAGUCCCAGAUAUGACCAGGAGCAUGCUUGAGAGUCAGCGACAUGCAAGCGAAUGAUAUGAGAAGUAGCUUGAGGGUGGAUCUUUGUCCAGGGAGGAGAAGGGUUGAGGGGCUCUUGGAACCUAGAUAUUUGCAGUGGAAGCAGCACUGGGCUCCUUGGCAGAUGACUGCUCUUUGUACUCAGGAUAAAACCCACAUUUGCUGCCCAGCAUCUGAGGCCCUGCCUACCUUGGGGAUGUUGUAAUGUUUUUCUUCCCCCUUAGUUCCAGCCACACUAAGGUUUUGAGCCUGAGAUCACCAGGCUCCCUGAGUCCUUGGCCUGUACCCUCACCUGCAAUGUUGGUUUCCUCAACCCCUCAGAUCUCUUACUUAAUGCCCCUUCCCUUUAAGGUGCCCCUUCACUUAAUUUAAGGGCACCUCCCUUCCUGCUAUCUUUUUAUUUGUGUGCUCUCUUGUUUCCUGUUUCCUGAUUGAGAGUCACCUCCUGGAUGGCAGUUCAGCUCUACUGUGUCCCCAUUGGAGACGCAGGCCCCACUGCCAACCACACAAGAAAUAGGCUCUGAAAUAUUUGUUGGAUCCAUGAAUGGUUGAUUGGCUUUCAUUGGGCUGCUGGGAGGAUUAAAUUAUGAAUGUAUAAAGGUGAUUACAUCUCAUUCCUAUAUACCCAUUACAUUGAUGGAUAAGUAUUAGGUUCUCUCUCCUCUUGCCAGGGACUUUAAGAAGCUGCUGAAGAACCCAAGAGGAAGGUGGGAGCUGUUGAUGGUGUGGAAUUAGAGGCCUGAUGGAGUGGAGAGCUUUCCUCCUCAUCACCUGGGUCAGGACCAUGGAGCUCCUUGAGCCUUGAGAUUCCAGGCCCAGGAGCACAUCAUCAUUGUGCUUCUUGGGGCCCAGGCGCAUCUCCUAAGAACUUGUUCUUAGACAUGUUGUGCUCAAACUUGUGGCAUCAUAGCAGUAAUAGUUUACAAUAUACCUACAGUUUCCUGGGCAGAUCAUCGUGUGCAGACCGGCUGCAGAGAGAAGGGAACUGUUUCACUUUCAUCUUCCUGGGCCAUUUCCAGAUAUGAAUUGCAGAGACAUAUUUCAAUAUAUCCUCACCCAAAUAUGCUUUAGAAGUACAUUUCUUUUAAUGUAAUAAGAUUUAUGUCCUUUGUGUUUGUUUAGAGGGUAAAUCUGGAUUUGUAUUUUUAGAAGUUACUUUCACCAAAGAAAUUCGAAAGAAAUAGUGUUUCAGAAAAAUCAAAACAAGCCAUAGAAAUCUAAUAUGUUUCAGAUACUAUAUUGGGCUGCAUGAAGACUAAAUCCAUAAUAUGUAUGAAUAAUGUAUUCUAAAGUAAAUAUCAUAUUUUGUCAAAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications