Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-5100 URS0000079F78_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-5100: Hsa-mir-5100 is a microRNA identified as a potential biomarker for ovarian cancer diagnosis from the GSE106817 datasets [PMC8656459]. It is also implicated in Alzheimer's disease-related neurofibrillary pathology, with evidence suggesting it may target the BCAS4 and SHISA7 genes, as found in a reanalysis of the GSE157239 dataset [PMC8899724]. This microRNA exhibits high expression levels in cancerous tissues, indicating its potential role in ovarian cancer pathogenesis [PMC8656459]. Further research interest has been shown in hsa-mir-5100 due to its unique presence in urine, distinguishing it from other microRNAs that are found both in urine and serum [PMC9463341]. Additionally, hsa-mir-5100 has been included among a select group of microRNAs for further investigation due to its relevance to disease processes [PMC6440664; PMC8640468].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAGAUCCCAGCGGUGCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications