Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3609 URS000006F90B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3609: Hsa-mir-3609 is a microRNA (miRNA) that has been implicated in the regulation of tumor proliferation, migration, stemness, and tumor-intrinsic PD-L1 expression in triple-negative breast cancer (TNBC) cells [PMC9659572]. This miRNA is located on chromosome 7 and has been identified as one of the most upregulated miRNAs in TNBC [PMC6541642]. Functional studies have demonstrated that hsa-mir-3609 can induce a significant reduction in CDK1 protein levels, suggesting a role in cell cycle regulation [PMC6541642]. Additionally, hsa-mir-3609 is predicted to have canonical binding sites on the CDK1 mRNA 3’UTR and is associated with an increase in nuclear-encoded miRNAs following ASK treatment [PMC6541642]. In the context of breast cancer, hsa-mir-3609 has been identified as differentially expressed in the blood samples of patients with locally advanced disease compared to healthy controls [PMC9727336], and it may regulate transcriptional levels of various extracellular matrix (ECM)-related genes and transcription factors [PMC4982685]. Moreover, it has been found to be abundant specifically in CD4+ T cells [PMC9031252], suggesting cell-type-specific expression. In prognostic studies, hsa-mir-3609 has been classified as one of three protective RNAs that may be part of an optimum prognostic signature for disease outcome prediction [PMC7541229]. Despite its emerging significance, research on hsa-mir-3609 remains limited compared to other miRNAs [PMC8350636].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGUGAUGAGUAAUACUGGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Macaca fascicularis microRNA miR-3609-3p
Relationships

Molecular Relationships

Publications