v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-30a-3p URS0000065D58_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-30a: The gga-mir-30a is a highly expressed miRNA that has been reported to regulate liver development and postnatal liver maturation by targeting ESRP2 [PMC5758705]. It has also been synthesized and inserted into pmirGLO vectors [PMC6406597]. Along with other miRNAs such as miR-133, miR-10b, miR-26a, and gga-miR-30e, gga-mir-30a is abundantly expressed in chicken somites [PMC4519947]. The gga-mir-30a belongs to a family of 5 members that share a seed sequence but differ at their 3' ends, allowing for an overlapping yet slightly different repertoire of targets [PMC7936154]. Studies have shown that gga-mir-30a expression is altered in the skeletal muscle during chick development and it can inhibit myoblast proliferation [PMC7936154]. Among the differentially expressed miRNAs in Gallus gallus, gga-mir-30a was found to be the highest differentially expressed one [PMC5214674].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUUCAGUCGGAUGUUUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30a-3p
  2. Anolis carolinensis aca-miR-30a-3p
  3. Cavia porcellus cpo-miR-30a-3p
  4. Chrysemys picta cpi-miR-30a-3p
  5. Columba livia (rock pigeon) cli-miR-30a-3p
  6. Cricetulus griseus (Chinese hamster) cgr-miR-30a-3p
  7. Danio rerio dre-miR-30e-3p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30a-3p
  9. Gorilla gorilla gorilla ggo-miR-30a-3p (MIR30A)
  10. Gorilla gorilla (western gorilla) ggo-miR-30a-3p
  11. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30a-3p
  12. Homo sapiens hsa-miR-30a-3p
  13. Ictalurus punctatus ipu-miR-30e
  14. Macaca mulatta (Rhesus monkey) mml-miR-30a-3p
  15. Mus musculus (house mouse) mmu-miR-30a-3p
  16. Ophiophagus hannah oha-miR-30a-3p
  17. Ornithorhynchus anatinus oan-miR-30a-3p
  18. Oryctolagus cuniculus ocu-miR-30a-3p
  19. Pan paniscus (pygmy chimpanzee) ppa-miR-30a-3p
  20. Pan troglodytes ptr-miR-30a-3p
  21. Pongo pygmaeus (Bornean orangutan) ppy-miR-30a-3p
  22. Python bivittatus pbv-miR-30a-3p
  23. Rattus norvegicus (Norway rat) rno-miR-30a-3p
  24. Salmo salar ssa-miR-30d-3p
  25. Sus scrofa (pig) ssc-miR-30a-3p
  26. Tetraodon nigroviridis Tni-Mir-30-P1b_3p (mature (guide))
  27. Tor tambroides miR-30e-3p
  28. Tursiops truncatus miR-30a-3p
 Publications