Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Sus scrofa (pig) microRNA 106b (multiple genes) secondary structure diagram

Sus scrofa (pig) microRNA 106b (multiple genes) URS00000600E6_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCCGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-106b precursor
  2. Callithrix jacchus miRNA (ENSCJAG00000025985.3)
  3. Castor canadensis (American beaver) miRNA (ENSCCNG00000007125.1)
  4. Cebus imitator microRNA 106b (ENSCCAG00000014683.1)
  5. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000015516.1)
  6. Chlorocebus sabaeus (African green monkey) microRNA 106b (ENSCSAG00000026020.1)
  7. Gorilla gorilla gorilla ggo-mir-106b (ENSGGOG00000031658.2)
  8. Gorilla gorilla microRNA ggo-mir-106b precursor
  9. Homo sapiens microRNA hsa-mir-106b precursor
  10. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000010833.1)
  11. Nomascus leucogenys microRNA 106b (ENSNLEG00000023974.2)
  12. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-106b precursor
  13. Pan troglodytes (chimpanzee) microRNA ptr-mir-106b precursor
  14. Papio anubis (olive baboon) miRNA (ENSPANG00000014575.3)
  15. Physeter catodon (sperm whale) microRNA 106b (ENSPCTG00005009726.1)
  16. Piliocolobus tephrosceles miRNA (ENSPTEG00000025919.1)
  17. Pongo abelii miRNA (ENSPPYG00000021087.2)
  18. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-106b precursor
  19. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 106b (ENSRFEG00010002858.1)
  20. Rhinopithecus bieti miRNA (ENSRBIG00000023519.1)
  21. Rhinopithecus roxellana miRNA (ENSRROG00000001775.1)
  22. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-106b precursor
  23. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000008334.1)
  24. Sciurus vulgaris (Eurasian red squirrel) microRNA 106b (ENSSVLG00005023692.1)
  25. Theropithecus gelada microRNA 106b (ENSTGEG00000011519.1)
2D structure