Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-345-5p URS000005D4F5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-345: Hsa-mir-345 is a microRNA that has been studied in various contexts. In a study, hsa-mir-345, along with hsa-miR-371a and hsa-miR-4476, was selected to create a miRNA-mRNA network [PMC8872348]. Another study identified 162 non-redundant target genes for hsa-mir-345 [PMC5260001]. It was found that increased expression levels of hsa-mir-345 were associated with increased lesion severity in the progression of leukoplakia to oral squamous cell carcinoma [PMC3990162]. In the context of depression, hsa-mir-345 was one of the miRNAs found to differ in peripheral blood samples from patients with depression compared to healthy controls [PMC9523516]. Additionally, hsa-mir-345 was shown to contribute to prognosis along with other miRNAs in a nomogram analysis [PMC9278893]. Furthermore, the expression levels of hsa-mir-345 were determined in the TCGA-LUAD database [PMC9160743]. It is worth noting that there are also other unique miRNAs identified from different datasets, such as hsa-miR-423-3p and hsa-let7i-star [PMC3281076]. Overall, these studies highlight the importance and potential role of hsa-mir-345 in various biological processes and diseases.

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGACUCCUAGUCCAGGGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Nomascus leucogenys nle-miR-345
  2. Pan troglodytes ptr-miR-345
  3. Pongo pygmaeus ppy-miR-345
Publications