Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR166e-3p URS000002C11C_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR166e-3p: Osa-mir166e-3p is a drought-responsive miRNA that targets alkaline neutral invertase and UDP-glucose 4-epimerase, which are involved in root development and carbohydrate metabolic processes [PMC4570225]. It is one of four drought-responsive miRNAs, along with osa-miR166h-5p*, osa-miR169r-3p*, and osa-miR397a/b, that regulate multiple biological processes in response to drought stress [PMC4570225]. In a study comparing a dwarf mutant (A1) with its wild type (A9), osa-mir166e-3p was down-regulated and targeted 21 genes, including homeobox-leucine zipper proteins, peroxidases, ABA responsive element binding factors, and ribonucleoside-diphosphate reductase subunit M2 [PMC4628322]. Additionally, osa-mir166e-3p was found to exhibit an opposite expression pattern in the shoot and root compared to oru-miR76, osa-miR1320-5p, osa-miR1432-5p, oru-miR75, and osa-miR398b [PMC5249095].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGAACCAGGCUUCAUUCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group microRNA osa-miR166e-3p
Publications