Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR2878-5p URS00000278CC_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR2878-5p: Osa-mir2878-5p is a microRNA (miRNA) that has been studied in rice in response to infection by the fungus Rhizoctonia solani [PMC9189367]. Differential expression of various miRNAs, including osa-mir2878-5p, has been observed upon R. solani infection [PMC9189367]. Osa-mir2878-5p, along with other miRNAs such as Osa-miR1862d, Osa-miR398b, Osa-miR166j-5p, Osa-miR156d, and Osa-miR169a, showed a differential expression pattern at different time points during infection [PMC7662745]. These miRNAs were generally downregulated during the initial time points of infection and upregulated during later time points [PMC7662745]. In addition to R. solani infection, osa-mir2878-5p has also been studied in the context of rice immunity against Magnaporthe oryzae [PMC7662745]. It was identified as a negative regulator involved in rice immunity against M. oryzae along with other miRNAs such as Osa-miR169a and Osa-miR398b [PMC7662745]. Furthermore, osa-mir2878-5p showed differential regulation against different strains of R. solani and M. oryzae [PMC7662745]. Overall, osa-mir2878-5p is an important miRNA involved in the response of rice to fungal infections and plays a role in regulating host-pathogen interactions [PMC7662745].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAUGUAUAAAAUUCUGAGGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group microRNA osa-miR2878-5p
Publications