v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Asp secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Asp URS0000022919_559292

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCAACAAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Saccharomyces cerevisiae (baker's yeast) tRNA-OTHER
  2. Saccharomyces cerevisiae Sigma1278b tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
  3. Saccharomyces cerevisiae W303 tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
  4. Vector YCy2508 tRNA-Asp
 2D structure