Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chlorocebus sabaeus mir-19 microRNA precursor family URS0000016B10_60711

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUAUGCAAAACUGAUGGUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Ailuropoda melanoleuca (giant panda) mir-19
  2. Bos taurus mir-19 microRNA precursor family
  3. Callithrix jacchus (white-tufted-ear marmoset) mir-19 microRNA precursor family
  4. Camelus ferus (Wild Bactrian camel) mir-19 microRNA precursor family
  5. Canis lupus familiaris mir-19 microRNA precursor family
  6. Cavia porcellus mir-19 microRNA precursor family
  7. Chelonia mydas mir-19 microRNA precursor family
  8. Dipodomys ordii mir-19 microRNA precursor family
  9. Erinaceus europaeus (western European hedgehog) mir-19 microRNA precursor family
  10. Felis catus (domestic cat) mir-19 microRNA precursor family
  11. Fukomys damarensis mir-19 microRNA precursor family
  12. Gorilla gorilla gorilla mir-19 microRNA precursor family
  13. Heterocephalus glaber (naked mole-rat) mir-19 microRNA precursor family
  14. Homo sapiens mir-19 microRNA precursor family
  15. Loxodonta africana mir-19 microRNA precursor family
  16. Marmota monax non-coding RNA
  17. Monodelphis domestica (gray short-tailed opossum) mir-19 microRNA precursor family
  18. Mus musculus mir-19 microRNA precursor family
  19. Myotis brandtii mir-19 microRNA precursor family
  20. Myotis davidii mir-19 microRNA precursor family
  21. Myotis lucifugus (little brown bat) mir-19 microRNA precursor family
  22. Nomascus leucogenys mir-19 microRNA precursor family
  23. Otolemur garnettii mir-19 microRNA precursor family
  24. Ovis aries (sheep) mir-19 microRNA precursor family
  25. Pan troglodytes (chimpanzee) mir-19 microRNA precursor family
  26. Papio anubis (Olive baboon) mir-19 microRNA precursor family
  27. Pongo abelii (Sumatran orangutan) mir-19 microRNA precursor family
  28. Saguinus labiatus (red-chested mustached tamarin) mir-19 microRNA precursor family
  29. Sarcophilus harrisii (Tasmanian devil) mir-19 microRNA precursor family
  30. Ictidomys tridecemlineatus mir-19 microRNA precursor family
  31. Sus scrofa (pig) mir-19 microRNA precursor family
  32. Tupaia chinensis mir-19 microRNA precursor family
Publications