This is the RNAcentral Browsable API. When this page is opened in a browser, it is rendered as a human-friendly document, but when the same page is requested programmatically, the response is returned in a machine-readable format. See API documentation for more details.

Rna Sequences

Unique RNAcentral Sequences

API documentation

GET /api/v1/rna/?format=api
HTTP 200 OK Content-Type: text/html; charset=utf-8 Vary: Accept Allow: GET, HEAD, OPTIONS
{ "next": "http://rnacentral.org/api/v1/rna/?format=api&page=2", "previous": null, "results": [ { "url": "http://rnacentral.org/api/v1/rna/URS0000A8E9AC?format=api", "rnacentral_id": "URS0000A8E9AC", "md5": "0002a9f0a11397f2219b1fa9ce9b7b5b", "sequence": "GCUGAAGACUUUACUGACUGUGAUAUCACAGAAAAUGCACUGGCUGUAUGUCUAGUUCAUCUUACCAACUCUGGAAUCAAUCUGAAAGCUUGUGGUAAAGAUGACAAGGGAGACUCCACAGUGGUUCUGCAAGGAGUUUAUGAUUCUCAAGAAGUCUUUUAAAUAGCAGGGCUUCCUCCACUCUGUACGGGUUCAGUAACAUGACAUCGGCUCUGGACGUGACCAGCCACGCAUCAGGAAACUUGAGACUGUGGAUCAGAGACCCUCCUGUGUGCUUAGGAUAAACUCCAAACAGAGCACAGAAAUCGGCCCCUGAAAAGCAGUCAAAAGCAAAUGAGAAAGGACUUGUACUUGCAUCCAUGAAGCCCGACCCAGCAUUAGCAGGUGGGAGCUGCAGGAAUCAGCUAGGAGAUGGAUGGCACUUAUUACUCUGUAUCAUCAGAACACAGAUCCUUGCUUCCAGAACAACUUAAAAUCAAGAGAAAAUCCCAUGUGUGAGAGCUCUCAGGAAAACAUUAAAACGCUAAUGAACUGAA", "length": 536, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000A8E9AC/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000A8E9AC/publications?format=api", "is_active": false, "description": "antisense_RNA from 0 species", "rna_type": "antisense_RNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000A8E9AD?format=api", "rnacentral_id": "URS0000A8E9AD", "md5": "2cd02c370ebdd6e078fa42f96108e2d6", "sequence": "CAAAUCAGACAUGCUCCACAUGAGAUUAUACAUAUGGAAUCAAACUUGCAAGGAAGACAAACUAGCAUUUGAAGACAACAGGUAUUUAUAAUACUCCAAACAUUCCACAAAAUAUUUCAUUGAGUACAAAGGACUAUAGGCCCAUGUAUUAUGUACAAGACAGUUAAAUGGGUAUUUUAUAUUUACACAUACCUAGUUUCAUACAACCAUCUUAAGUCAAAUGCACUUCAAUUUUCAGUUUAAGAACCUUAGAAUUUAUUAGUUUGUAAGAGGCAGCAUUUGAAUUUAUAUAGUAGUCAUAACCUCAACUCUAGAUUAUGUGUUGCUGUUCAUACUUUCUAUUCCUUGACUUCUUGUUGAAUGUGAGGUAUCCUGAGCGACAUAGUGUUAAAAAUCCAUUAGUUGUGGUCUGGAGUCAGUUCUUAUGGAUUGUCUUAAACAACAAGGAUGAUUUACUGGCUAAUAGACUUUGUCAACUUUCUUCAAGACAAAGGGAAAUAUGGAAGGCAGAGGGCAUGGAUAUUACCCUGACCUAGCUUUAGGCUUUUUUGAGAAAAUGAGCUAGAGUAAAUGGUAAGCAUCAAGGCCAGAAGUAAGAGCAGAAACGGAU", "length": 610, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000A8E9AD/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000A8E9AD/publications?format=api", "is_active": false, "description": "antisense_RNA from 0 species", "rna_type": "antisense_RNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000A8E9B1?format=api", "rnacentral_id": "URS0000A8E9B1", "md5": "2cd2324703ace6403599d7099268a947", "sequence": "AGCUUUGCACAGUGGCAGUAUCGUAGCCAGUGAGCUUUACCCGAGGCGCGAAUAUUGCUAGUUAAAUAUUUAUAAAAACCUUUCGAGCAGCGCCUGAACAAGAAUAGGUUAAGAGGAGCUCC", "length": 122, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000A8E9B1/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000A8E9B1/publications?format=api", "is_active": true, "description": "snRNA from 1 species", "rna_type": "snRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000A8E9B2?format=api", "rnacentral_id": "URS0000A8E9B2", "md5": "8c99d7fd1f9f59ebe4cbf3d1e4aa2be4", "sequence": "ACCUUCCAAAUUCCUUGCCCUUCGGAUCUAAACACGGGUCUGAGUGGUUAUAAACGCAGGAAAAGUAAAACUGAAACGGACUUAAAUUCUUUGUGACACAUGAGCUAGUUUCAAACUAAA", "length": 120, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000A8E9B2/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000A8E9B2/publications?format=api", "is_active": true, "description": "snoRNA from 1 species", "rna_type": "snoRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000A8E9B3?format=api", "rnacentral_id": "URS0000A8E9B3", "md5": "06e64ce6886d5def30dfcc288543f8df", "sequence": "GUUGGCUUAGCAGUUAUGAUUUGGGCCCAACUUUCCUGACCUUCUAAAUAGAGGUAAAAUAACAUUGAGUGAACAUAAGCACAAAGAAAAUACGGCAGAUACUUUGGAUGGCCUUCCUAGUACUCCCGGCUAUCUUUGCUUCAGUGAGCUCCAACUGACUUCCAACUGCCAGUAUUCUCUUGGCCUUGAGGCUUUCUCUGAAGCUUCAAAGACUACUCUGCCUAUUCGCAUGGCAGGCCAGACCAGCCAGGAAAAACACAUCUUCUUCUAUCCUUGUGGCAUUUGGCUGAUGCCUGAUGAGGAUUCCUGUCUUCUCUGGUCAGAAACAAUUUUGCACGCUGAGUGCUGA", "length": 349, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000A8E9B3/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000A8E9B3/publications?format=api", "is_active": false, "description": "lncRNA from 0 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000A8E9B6?format=api", "rnacentral_id": "URS0000A8E9B6", "md5": "8c9a3027fa7f0766de68b96edb8cb272", "sequence": "UCUAUGGGGUCUCAAUGGGCUCUGUGGGGUUUCUAUGGGUUCUGUGGGGUCUCCAUGGGCUCUGUGGGUUCUAUGGGGUCUCCAUGGGUUCCUUGGGUUCUAUGGGGUCUCAAUGGGUUCUAUGGGGGUCCCAGUGGGCUCUAUCUGUUCCAUGGGGUCCCAGUGGGCUCUAUGGGUUCUAUGGGGGUCUCAAUGGGUUCUAUGGGGGUCCCUGUGGGGUUCUAUGGGGGUCCCAAUGGGUUCUUCGGGGGUUCCAAUGGGUUCAGUGCAUCACAAUUGGGCUCUAUGGGUUCUAUGGGGUUCGAAUAGGCUCUAUGGGGUCCCAAUGGGUUCUAUGGGGUCCCAAUGGAUUCUGUGGGGGUCCCAAUGGGCUCUAUGGGUUCUAUGGGGUCCCAAUGGGUUCUGUGGGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGGUCCCAAUGGGCUCUAUGGGUUCUAUGAGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGGUCUCAAUGGGUUCUAUGGCGUCCCAAUGGGUUCUUUGGGUUCUAUGGGGUUCCAAUGGGUUCCUUGGGUUCUAUGGGGUCUCAAUGGGUUGUAUGGGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGGUCUCAAUGGGUUCUAUGGGGUCCCUAUGGGUUCUAUGGGUCCCAGUGGGCUCUGUGGGUUCUAUGGGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGGUCCUGUGGGUUCUAUGGGGUCCCAAUGGGCUCUGUGGGUUCUAUGGGGUCCCAGUGGGCUCUGUGGGUUCUAUGGGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGAUCCCAAUGGGUUCUAUGGGAUCCCAAUGGGCUCUAUGGGUUCUAUGGGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGGUCUCAAUGUGUUGUAUGGGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGGUCUCAGUGGGUUCUGUGGGUUCCCUAUGGGUUCUAUGGGGUCCCAAUGGGCUCUAUGGGUUCUAUGGGGUCCCAAUGGGCUCUAUGGGUUCUAUGGGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGGUCUCAAAUGGGUUCUAUGGGGUCCCAGUGGGCUCUAUGGGUUCUAUGAGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGGUCUCAAUGGGUUCUAUGGGGUCUCAAUGGGUUCUAUGGGGUCCCAGUGGGCUCUAUGGGUUCUAUGAGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGGUCUCAAUGGGUUCUAUGGGGUCCCAAUGGGUUCUUUGGGUUCUAUGGGGUUCCAAUGGGUUCUUUGGGUUCUAUGGGAUCCCAAUGGGAUCUGUGGGUUCCUUGGGUUCUAUGGGGUCCCAAUGGGCUCUAUGGGUUCUAUGAGGUCCCAAUGGGUUCCUUGGGUUCUAUGGGGUCUCAAUGGGUUCUAUGGGGUGCCAAUGGGUUCUAUGGGGUGCCAAUGGGUUCUUUGGUAUCAGAGCAAGCUGAUAGCGGGGAAGAUCAUCCCGGCCAUCGCCACGACGACGGCGGCGGUUGUGGGGCUGGCGUGCCUGGAGCUCUACAAAGUGGUGCAGGGCCACCGGCGCCUCUCCUCCUACCGCAACGCCUUCCUCAACCUGGCGCUGCCCUUCGUCGCCUUCUCCGAGCCCCUGGCCUGCCCCCGGAACAAGUACUACGAGGUGGAGUGGACGCUGUGGGACCGCUUUGAGGUUCAGGGGCUGCAGCCCGACGGGCAGGAAAUGACGCUGCGCCAAUUCCUCGCAUACUUCAAGGUAUGGGCAGACCCCAGCCCUGCCCCCCAUCUAUGGGUCUGACCCCCAUCUAUGGGUCUCACCCCCAUCCCUGCCCCCCAUCUAUGGGUCUGACCUCCAUCUAUGCUCCCCCCUCGUCUCCCCCAUCCCUGCCCCCAUCUAUGGUCUCACCCCAUCUAUGGGUCUCACCCCCAUCUGUGGCUCUGACCCCCAUCCCUGCCCCCCAUCUAUGGUCUCACCCCCAUCUAUGGGUCUCACCCCCAUCUGUGGCUCUGACCCCCAUCCCUGCCCCCCAUCUAUGGGUCUGACCCCCAUCUAUGGGUCUCACCCCCAUCUGUGGCUCUGACCCCCAUCCCUGCCCCCCAUCUAUGGUCUGACCCCCAUCUAUGGGUCUGCCACCCCCCAUCUAUGGGCUCUCACCCCCCAUCCCUGCCCCCCAUCUAUGGGUCUCACCCCCAUCUAUGGGUCUCACCCCCAUCUGUGGCUCUGACCCCCAUCCCUGCCCCACAUCUAUGGGUCUGAGCCCACACAUCUAUGGGUCUGAGCCCCCCAUCUAUGGCUCUGAGCCCCAUCCCUGCCCCCCAUCUAUGGGUCUCAGCCCAUCCCUGCCCCCCAUCUCUGCCUCUGCCCCCCAUCUAUGGGUCUCACCCCCCAUCUCUGCCCCCCAUCUGUGGCUCUGCCCCCCACCCCCAUCUCUGCCCCCCAUCUAUGGGUCUCAGCCCCAUUCCUGCCCCCAUCUCUGGCUCUGCCCCCCAUCUAUGGGUCUCACCCCCAUCUCUGCCCCCCAUCUAUGGGUCUCACCCCCCACCCGUGGCUCUGCCCCCAUCUAUGGGUCUCACCCCCCAUCUCUGGCUCUGCCCCCCAUCUAUGGGUCUCAACCCCAUCCCUGCCCCCCAUCUAUGGGUCUCACCCCCCAUCUCUGGCUCUGCCCCCCAUCUAUGGUCUGACCUUCAUCCCUGCCCCCCAUCUAUGGGUCUCACCCCCAUUCCUGCCCCCCAUCUCUGCCUCUGCCCCCCAUCUACGGGUCUGACCCCCAUCCCUGCCCCCCAUCUAUGGGUCUCACCCCCAUCCCUGCCCCCCCAUCUAUGGGUCUCAGCCCCAUUCCUGCCCCCCAUCUCUGCCUCUGCCCCCCAUCUAUGGGUACGACCCCCAUCUCUGCCCCCCAUCUGUGGCUCUGCCCCCCCACCCCCAUCCCUGCCCCCCAUCUAUGGGUCUCAGCCCCCCAUCUCUGGCUCUGCCCCCCAUCUCUGCCUCUGCCGCCCCAUCUCUGCCUCUGCCCCCCAUCUAUGGGUCUGACCCCCAUCCCUGCCCCCCAUCUGUGGCUCUGCCCCCCAUCUAUGGGUCUCAGCCCCAUUCCUGCCCCCCAUCUCUGCCUCUGCCCCCCAUCUAUGGGUCUCAGCCCCAUUCCUGCCCCCCAUCUCUGCCUCUGCCCCCCAUCUAUGGGUCUCACCCCCAUCCCUGCCCCCCAUCUAUGGGUCUCAGCCCCCAUCUCUGGCUCUGCCCUCCAUCUAUGGGUCUCACCCCCCAUCUCUGACUCUGCCCCCCAUCUAUGGGUCUCACCCCCAUCCCUGCCCACCAUCUAUGGGUCUCAGCCCCAUUCCUGCCCCCCAUCUCUGGCUCUGGCCCCCCAUCUAUGGGUCUCACCCCGUCCCAUCCCUGCCCCCCAUCUAUGGGUCUCAGCCCCAUUCCUGCCCCCCCCAUCUCUGGCUCUGCCCCCCAUCUAUGGGUCUCACACCCCCAUCCCUGCCCCCCCCAUCUAUGGGUCUCAGCCCCCAUUCCUGCCCCCCAUCUCUGGCUCUGCCCCC", "length": 3574, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000A8E9B6/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000A8E9B6/publications?format=api", "is_active": false, "description": "lncRNA from 0 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000A8E9B7?format=api", "rnacentral_id": "URS0000A8E9B7", "md5": "06e6718800544ac0f4db467137747995", "sequence": "AAUACAGGACACCCAAUUCAAUUUGAAUUUAGAUAACCAAUGAAGAAUGUUUUAGUAUAAGUAUGUCCCAUGCAACAUUUAAGACAUACUUAUGCUAAAAAAUUCUUCAUUAUUUAUCUGAAACUCAAAUUUAACUGGACAGUCUCUAUUUU", "length": 152, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000A8E9B7/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000A8E9B7/publications?format=api", "is_active": true, "description": "miRNA from 1 species", "rna_type": "miRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000A8683C?format=api", "rnacentral_id": "URS0000A8683C", "md5": "5c1839875df34b146d3d00875bbaaf20", "sequence": "GGCUAGUCCAGCGGUAGUGGGAUAUCAGAACUUACUAACAUUAGUGUCACUAAAGUUGGUAUACAACACCCGCUUCCACCCCACUAAAUUUGAGUGGUUUAAA", "length": 103, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000A8683C/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000A8683C/publications?format=api", "is_active": false, "description": "misc_RNA from 0 species", "rna_type": "misc_RNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000A8683E?format=api", "rnacentral_id": "URS0000A8683E", "md5": "3c051e49ea2e0bdd6aa621db9b33efb4", "sequence": "UUGCAGUACCUUUGGAUCCAUCAAACUCACGUCGUGCAGUUGGAUUCCUCCUCAUGAGAAUUCUGGAUUUUAUGCUCACUGGCUGUGUGCACUGGCUCACCAUUCACCACCUGCCUGCCCCUCUGCCCACGCUGUCUCAGACUGCAGAGCGCUCUCUGGAUCUGGACUCCCGGCUCACCCAACUUUGCACCGGUCACUCACCUGGCCUUCCGCAGCUACCCUCCCAUGCUGACUACCUCUCGUCUGUAAAAAGCUCCACUUAUCACGGGCUUCCCCUGUGCACCUGAGAACUCCCUGUGCCUUUUUAUUAGUUGUAAAUACUUCAGUGAUUCCGAC", "length": 336, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000A8683E/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000A8683E/publications?format=api", "is_active": false, "description": "lncRNA from 0 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000A86840?format=api", "rnacentral_id": "URS0000A86840", "md5": "5c19569cae26b5e3af67687eb3435abe", "sequence": "CUGCCAUCCCACACUUAGAUUGUAGGCCCAUUGGAAAGGUUAGUGUCUUGACCCCAAUGGGCCUACAGUCUAAGUGUGGGAUGGCGG", "length": 87, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000A86840/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000A86840/publications?format=api", "is_active": true, "description": "miRNA from 1 species", "rna_type": "miRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] } ] }