This is the RNAcentral Browsable API. When this page is opened in a browser, it is rendered as a human-friendly document, but when the same page is requested programmatically, the response is returned in a machine-readable format. See API documentation for more details.

Rna Sequences

Unique RNAcentral Sequences

API documentation

GET /api/v1/rna/?external_id=MIMAT0000091&format=api
HTTP 200 OK Content-Type: text/html; charset=utf-8 Vary: Accept Allow: GET, HEAD, OPTIONS
{ "next": "http://rnacentral.org/api/v1/rna/?external_id=MIMAT0000091&format=api&page=2", "previous": null, "results": [ { "url": "http://rnacentral.org/api/v1/rna/URS0000483184?format=api", "rnacentral_id": "URS0000483184", "md5": "48dd7b46f771d738ee8ef38eef95875b", "sequence": "GUGCAUUGUAGUUGCAUUGCA", "length": 21, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000483184/xrefs?format=api", "publications": "http://rnacentral.org/api/v1/rna/URS0000483184/publications?format=api", "is_active": true, "description": "miRNA from 60 species", "rna_type": "miRNA", "count_distinct_organisms": 60, "distinct_databases": [ "ENA", "GeneCards", "IntAct", "LncBase", "MalaCards", "miRBase", "MirGeneDB", "PirBase", "RefSeq", "TarBase" ] } ] }