Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
tRNA (Asp) from Homo sapiens (PDB 8JDK, chain B)
URS00029156D4_9606
Genome locations
Gene Ontology annotations
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
![]()
Sequence
Contains ambiguity characters: 1 X
IUPAC notation
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset
UCCUCGUUAGUAUAGUGGUGAGUAUCCCCGCCUXUCACGCGGGAGACCGGGGUUCGAUUCCCCGACGGGGAGCCA
Taxonomic tree
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree.
Click tree nodes to collapse or expand them.
Hover over taxon names to display additional information.
Download
