v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Transcription-like product from Tilapia lake virus (PDB 8PSX, chain P) URS0002915695_1549864

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAAUAUAAUACCAAAUUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications