v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) RB1 divergent transcript (RB1-DT) URS0000E60ABC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RB1-DT: RB1-DT is a long non-coding RNA (lncRNA) expressed from the RB1 promoter and is involved in the inhibition of tumor antigen release through the expression of chaperone calreticulin [PMC8534192]. Deletion events in various genes, including RB1-DT, have been observed, which can have an impact on tumor development [PMC8117561]. Downregulation of key genes involved in cell cycle/apoptosis (MDM2, TP53AIP1, RB1-DT) and DNA repair/damage (BRCA1, BRCA2, ATM, WRN) has been observed in human osteosarcoma [PMC9813000]. In esophageal squamous cell carcinoma (ESCC), the expression of RB1-DT is downregulated compared to normal tissues [PMC9315452]. This study also reports an association between ESCC prognosis and RB1-DT as well as other lncRNAs such as LOC100507144, LINC02269, LINC01970, and APOA1-AS [PMC9315452]. In ESCC prognosis models, LOC100507144, LINC02269, and EBLN3P are upregulated while SNHG29, RB1-DT MEG3 LINC01970 FAM13A-AS1 CAHM and APOA-AS are downregulated [PMC9315452]. A regression model for ESCC prognosis includes ten prognostic lncRNAs: SNHG29 RB1-DT MEG3 LOC100507144 LINC02269 LINC01970 FAM13A-AS EBLN3P CAHM and APOA-AS [PMC9315452].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACGUCCGCGAGGCUCCCGGGCCCGCCGGCGUCUGUGGGGAACUGGGGCGCUGGUCGGUGCGCGGGCUGGGACGCUAAGUCAUGAGGAAUUAAACUGGGAAACCUGGCGUGGGUCCAGGCGCCUUCCAGGAGGCAUCCGGCGCGGCCCGGACGUGCUUCUACCCAGAACCACCCCCUCCAGGCCGGGGUGCACUUAACGGGGCUAUACAAAGAGUCUGGUGGGUGACUGUGGGCCUCAUCCCUAUCCCGGGGUCUGAUAGGGAAGACUCUCGGGCCCCGCAGGGAAUAUCUGGCUAGUGCACCCUCGGCGGGAGCGCCACUCUCCCUCCUUGGGCGGCGCCCCCCACCUCUCAUCCCGCCCAAUCCGUUUUGCAAAGUCGGCCAAAACAAAAACAAACUUGGAGCGCUGAUAGACACUGUUAUUGCCCAUCUGAACUCGUCAACUGAGAAGGAAAGAGAUGGUUUAUGCUGUGAAUAAAAUACAGUUGUGCUGUGAUGUAAAUCCCCUCAUCCUGGAGCAGCUGAGCAAGGUCUAAGGCAGGAAGAACCUUCAAGCAGGUCAUGGCUUGCAGGCUCAACUCUGCCUGGCAGUGGCAAGGGCCAGGGCCAGUGACUGAAGCAACAAACUGCCAGAUGACUGCAGCUCAAGCCAAUGCACAAAGCCACUGCAACAAGAGAGGAAAUUCUUCCAUUUCCAAGUGUGUCGAUUUCUCCCCAUCAAGGAAAACAGCUAAGGCAAUGUGUUGAUAUUUUCUUUGACCAAGUCAUCAGGAGUCACAUAGACAUACAGCACUCAAGAAGUGGCUGUAACUAAAGGCACAUCUCGUUCAUCUACAACCCUUGUAAUCCCAACCUUUGUCUGAUGCACAAACCCUUCCCUAGUUCUCCCCACCACCACCACUGCACCUCCAAGUGGGGACAACGAAUUGUUUCAUUUGCAUGUGGUUUUUCUCAUGAAAAAUAUCAUUAACAUGAGACAGCCCCAAACCAAGGAAACCAGAAGUGGGGUUUGUGCUUGGUCUUACUGAGAGCUUUCCCUACUUGACCAGACCCCAGCAUUGUUCUAGAUUUGUCUCUUGUGGGCUACAGGAAUGCAAACAUUUUGUAGUUUCCUCUUUUUUGUUUUCUUAAUGGCUUGAUGAGCCACACAUGUUUCUCUAAAUGCAUGAUUUUAAAUUCACACAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications