v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SERTAD4 antisense RNA 1 (SERTAD4-AS1) URS0000D77F5A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SERTAD4-AS1: SERTAD4-AS1 is a non-coding RNA (ncRNA) that affects cells in the NSC lineage and is also involved in cell cycle regulation [PMC9648144]. In a study on hepatocellular carcinoma (HCC), it was found that the expression of SERTAD4-AS1, also known as C1orf133, is correlated with prognosis and is associated with the response to transarterial chemoembolization (TACE) treatment [PMC9877416]. Perturbation of SERTAD4-AS1 leads to changes in cells at the far end of the non-CNS ectoderm trajectory, which are believed to be neural crest derived [PMC9648144]. These findings suggest that SERTAD4-AS1 plays a role in neural crest development and may have implications for HCC prognosis and treatment response. Further research is needed to fully understand the mechanisms by which SERTAD4-AS1 influences cell lineage and cell cycle regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGCUCCAGCCCGCAGCAGAUGUCGGCCCGGCCUUCCCUCCCUCCCUUGCCGGCCAAACCCGCUGGAAGCCCGCGGUUGCGGGAGCGCCCUGCGCCCGUGGGACCUGGCGGCGAGGACGCCUAUUCCCUGCUUCUGCGACCACAGCUGGGCACUCGGAAAGUUGCUAGGGCCGAAGAGGCGGGAGGGGAGGAAGGGAAGCGAGAGGCGGAGGCGUGGACCAGGCGGGCAGCAGCCUCAGCCCGCCGAGGAGUGAUCCUCCGACUGUGAAAAACCAGACCUCUGGCUGCCUGGCUCCCUAGGAAUCAAGAAGACGCACAGACUGAAAAUCAAGGGAGGAAGGAACAAGAUCAAGGAUGAGGAUUAGCAUCUGCAAAUUGAACUCUAUCUAAUUUGCAUGUUUAUUUCUUAGAAUUGUAAUUAAAUUUGUGUAAUAAAUGUUUUCCAUUUCAUUUGUACACUUAAAACUUGGGUGACUGACAUGCAGUUAAGUGAAUUUCCUUUUUUUAAAAGCAAAUGUAGAUUAUUCAAUAAAGCAGCAAACCAAUAUUAAACAUAAUUAGAACUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications