metY SAM V (53-MER) from Candidatus Pelagibacter ubique HTCC1062 (PDB 6FZ0, chain A)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

metY SAM V (53-MER) from Candidatus Pelagibacter ubique HTCC1062 (PDB 6FZ0, chain A) URS0000D77952_335992

53 nucleotides
2 databases (PDBe, Rfam)
Found in 1 other species
4 publications
1. mRNA region
2. riboswitch

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGGCGCAUUUGAACUGUAUUGUACGCCUUGCAUAAAGCAAAAGUACUAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Methylovorus glucosotrophus metY SAM SAM-V sequence

2D structure

Publications