Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-320a precursor URS0000D53E88_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR320A: MIR320A is a microRNA that has been studied in various contexts. In one study, a sponge320a expressing vector was transfected into HeLa cells to reduce the levels of endogenous MIR320A, allowing the researchers to test a hypothesis [PMC5363649]. Another study analyzed the effect of different doses of UVC radiations on HeLa cells that had been stably silenced for MIR320A, in order to assess its relevance to the DNA damage response [PMC5363649]. MIR320A has also been identified as a sensitive and specific diagnostic marker for myocardial infarction, along with miR49922 [PMC7123062]. In hepatocellular carcinoma cells, Vps4A was found to selectively encapsulate oncogenic miR-27b-3p and miR-92a-3p into exosomes and secrete them out of cells, while accumulating oncogenic miR-193a-3p, MIR320A, and miR-132-3p within the cells [PMC9240252]. The relative quantification of various microRNAs including MIR320A validated the results obtained from Illumina sequencing in another study [PMC4486185].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCCCCUCCGCCUUCUCUUCCCGGUUCUUCCCGGAGUCGGGAAAAGCUGGGUUGAGAGGGCGAAAAAGGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications