v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 515 (LINC00515) URS0000CCE13C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00515: LINC00515 is a long non-coding RNA (lncRNA) that has been studied in glioma cells [PMC6497836]. In a study by (2020e), siRNAs were used to knockdown LINC00515 expression in U251 and U87MG glioma cells [PMC6497836]. This study aimed to further explore the function of LINC00515 in glioma cells [PMC6497836]. Additionally, (2020e) identified five immune gene-related lncRNAs, including LINC00515, that were correlated with glioma patient prognosis and clinical characteristics [PMC9068894]. These lncRNAs were also found to be positively correlated with the expression of immune checkpoint proteins PD-L1, TIM-3, and B7-H3 [PMC9068894]. This suggests that LINC00515 may play a role in immune regulation and potentially contribute to the development and progression of glioma [PMC9068894]. The knockdown of LINC00515 expression may provide insights into its specific function in glioma cells and its potential as a therapeutic target [PMC6497836]. Further research is needed to fully understand the mechanisms by which LINC00515 influences immune regulation and its implications for glioma treatment [PMC9068894].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCUGCCCUUCCUUGCAGCUGUGGCUCAGACAGGUAGCAUGGGCUCACCAAUUAGACAUAACUGUGUGAAAUCUGGAAGCAAGUACUUUGCAGACAAGAGUAGUAUGAGAUACAUUUUGUUGAACGGAGCAGUGAUGUGGUUUUCAAGGCAGCAGUGGCAGAGGUCCCAUGUAAUGGUGCAAGGUGUGGAGGCUUUGCUUAGCAGUUUUUCCCCCGCAGCUGCUCCAAGGUAUAAAAAUGGGCAUUUUUGGGGGCUCCGUAGUCCUGACCUCCACGCCUGUGACUUGUGAGCCAUUUUAUUCUGUUUGUUUAAACUAGCUAGUGUAGAUCCUGUUGUUUGUAACCAAGAGUGUUGACAUACAGCCACUAUUUAAUUGUAACCACUGUCAACCUUUUUCCUUAUUUCCUUCAGAUCCUUUUGUGUUUAAAUAAAGGAAAAGCUGCACAUCCAAAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications