v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2870 (LINC02870) URS0000CCE032_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02870: LINC02870 is a long non-coding RNA (lncRNA) that has been investigated in liver cancer cells. Its expression, along with AL590705.3, KDM4A-AS1, and MKLN1-AS, was detected in various liver cancer cell lines [PMC10086263]. These four lncRNAs were identified and their expression levels were measured using qPCR [PMC10086263]. A risk score formula was computed based on the expression levels of these lncRNAs [PMC10086263]. Inhibition of AL590705.3, LINC02870, MKLN1-AS, and KDM4A-AS1 decreased cell proliferation and increased FDX1 expression, suggesting their involvement in the progression of cuproptosis [PMC10086263]. LINC02870 has also been implicated in the development of a hepatocellular carcinoma (HCC) prognostic model [PMC10086263]. Additionally, LINC02870 has been shown to promote tumor progression in HCC by inducing SNAIL translation [PMC9579291]. It is considered a risk factor for overall survival (OS) in HCC patients [PMC9579291]. A prognostic signature for HCC patients was constructed using LINC02870 and other DElncRNAs through multivariate Cox regression analysis [PMC9579291]. LINC02870 was found to be positively correlated with CDKN2A, an essential regulator of immune cells used as a prognostic biomarker for determining prognosis and immune infiltration in HCC patients [PMC9579291]. It is also included in a risk score formula along with other lncRNAs for determining patient risk scores [PMC9557293].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCAGGAUCUGCCAGGACUGGGAAGGGAGGCAGGAGGCUUCUCUGGGUAUAAAGCAGCUGAAAUGUGGAGUUUCCUCCCAGGAGCUGAGAGCGUGUCCAUGGGCCCAGUGCCUGGCGUGUCCUCCCUGGGAGCUUGCUGGACGCAUGACCAGGAUUCUGGGAGGGCAGAGGACAGACCACAGGCACCCAGGAUAACUCAGUACACAUGGGUUCUCAGCUUCCUGUUCACAGAGAAACCUCAGACAAGAAGCACGUCGCCCAUUUCUCAUCAAGGCCAACCCCAGACCACGAGAGCGCUUUCUCUGCGUCAGCCCCAGCACCCCAGCGCCCCUGCCUCCGGGCGCCCGCGGCCUCCGCACUCCAGUGGCCCAGACCUGGCUGAGGCAGCUCCCGUGGUAGAUCAAGCCUCACAGGCGGCUGGAAGAGCCAGUUCUGGGCUGGGCCUGUGGGAACAGGCGUCUGUUAGUCAGGGUUUCAGGAAUGCGGCCUUCGAAGCCUGAAGCGGGGAAUGGCGGCUCUGGGCCCUCAAGGGGCAGGCGGUGAGCCUGGGAGGCCAGGCCGGGCUGACCCAAGGGGAGAGGACCCUCUCCGCCCACUGCCGCUGGCCCUGGGCAGGUCUAGAGCCUGGGGGUCUCCAGAGGCACAAUCCCUUAUCUCCGGGAGAAGGCAGAGGGCAGAGGCAGGAAACAAAUCUCCUGUCAAAAUUCCUAAUUAAAAUACUAAGUAAGUGAUGGCUCCAGGCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications