v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1852 (LINC01852) URS0000BC44CE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01852: LINC01852 is a long intergenic non-coding RNA (lincRNA) that has been identified as a potential prognostic biomarker in prostate cancer (PCa) [PMC9556775]. In a study, LINC01852 was found to be negatively associated with risk scores in PCa [PMC9556775]. The risk score calculation included LINC01852, along with other lincRNAs such as AC005253.1, LIMD1-AS1, AC127502.2, AC068580.3, and AC129507.1 [PMC9556775]. However, it was observed that the expression of LINC01852 and AC127502.2 was upregulated only in DU145 cells [PMC9556775]. The expression of these lincRNAs was verified using RT-qPCR in PCa cell lines and RWPE1 cells [PMC9556775]. The study established a risk model based on these six lincRNAs to forecast PCa outcomes [PMC9556775]. Among the six lincRNAs, AC129507.1, AC068580.3, and LIMD1-AS1 were previously associated with different cancers while AC005253.1, AC127502.2, and LINC01852 were identified for the first time as potential prognostic biomarkers for PCa [PMC9556775]. In conclusion, the study successfully developed a risk model using six lincRNAs including LINC01852 to predict outcomes in PCa patients [PMC9556775]. The findings highlight the potential importance of these lincRNAs as prognostic markers for PCa and provide insights into their roles in cancer development and progression [PMC9556775]. Reference: [PMC9556775]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGGAUGAAUGGGGCUUUGUUCGUAGGCAGCCGCGGCUACCCUCUGCAGGCCCGGCCCGCACAACAGAGGCUGUAUGCGAGAGGAAUGGAAAUGAGCCUCAGGCCCUGCCGAAGGAGCCCCAUCCCCUUCCCCGCGCGGGGCUGAGGAAUGCUGGCCAGCCGGAAAGGAACCCUCGCUGGGAACGCCGCUCUCGCGCCUCUGAAACCCCAUUGAGAAGAACCCUUUGAUGCAAUUAAAGCGCAUUUCAUUGCAGGCCUGGGAGGAGGGAACGACCGGCAAGCUUUUUUCUGUCUCGGACGUGUGUAUGCACCUUUGUGGGCCGGGUUACUUAGAGACCAGGCGGGAACUUGAGCUCCCUCUCUCGCAGACGUUCUGUAACAUCAGAAAAGCGUACCCAUAAACAGAUUGGUUUUCACCAGGGGUGGAACUCAAUUUGGACACGAUCCAGGCUGACCUGCAGGCCGGGGUUCCUACUUUGAAAGGCUCUUUGGUGCGCCUUACACCCACCUUCCCUGCUGUAAAGGUUUAGGCGGAAAAGAAAUUGCGUUUGCAGGAGGAAGUUGUUUCUGAGGUUACUGCUCAGCAUUUUCCAUUUUCUCAGUGGUGGGGUGGGCCGUGUCGCAUAUCCAGAAGUGAUGUCACAGCCAGACCUGCAAAAUGAUGUAACCUGCAAGUGUUGAAGGACGACGAUGGGACAGCUAUUUUGAUACUCGUAUUAUUUUAUAACAUUUCCCUGCUUUUUCCAUUGAGACAACUGUGUGACCUCAGAAAAUCCACAUAGCCUCUCUGAACUUAGUAUUUUUGUGUGUGUGUUAAAAUGAGUAUCACAAAGCCGGAGAACGAAUGUGAUGAAGUUCUGGGUGCUUGUGGAAUUCUUUCUAAGUUGGAGGUGGACACUUUAUCUACCUGCACAGGUGGAAGAUAUGUGGGUCUGGAACUCCGGUAAACAAAAAGAUCCUAUUGGGACCUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications