Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FOXP3 regulating long intergenic non-coding RNA (FLICR) URS0000BC43DA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FLICR: FLICR is a long non-coding RNA (lncRNA) that has been found to be significantly elevated in multiple sclerosis (MS) patients compared to controls [PMC9461285]. Additionally, FLICR has been shown to inhibit the expression of Foxp3, a transcription factor involved in the development and function of regulatory T cells (Treg cells) [PMC8954347]. This inhibition of Foxp3 by FLICR leads to the suppression of Treg cells by modifying chromatin accessibility [PMC8954347]. The elevated expression levels of FLICR in MS patients suggest a potential role for this lncRNA in the pathogenesis of MS [PMC9461285]. The suppression of Treg cells by FLICR may contribute to the dysregulation of immune responses observed in MS patients, as Treg cells play a crucial role in maintaining immune tolerance and preventing autoimmune diseases [PMC8954347]. Further research is needed to fully understand the mechanisms by which FLICR affects Foxp3 expression and Treg cell function, as well as its potential as a therapeutic target for MS.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGGCCCAUUCUGGGCUUUUCCAGAAGGGUCUGAAGCCAGUCUUGUAGAGGGCUGGAGUGGUUGUUGGACGACUAGAACCCUGGGCUUUGCAGGGUGCUGGGAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications