Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 976 (LINC00976) URS0000ABD872_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00976: LINC00976, a long non-coding RNA (lncRNA), has been implicated in the progression of cholangiocarcinoma (CCA) and pancreatic cancer (PC) [PMC9674662]. Bioinformatic analysis and subsequent functional validation have shown that LINC00976 upregulates the expression of GPX4, a key enzyme involved in protecting cells from oxidative damage, by acting as a sponge for miR-3202 [PMC9674662]. This upregulation of GPX4 by LINC00976 leads to the suppression of ferroptosis, as well as the promotion of proliferation, migration, and invasion in CCA [PMC9674662]. Additionally, LINC00976 overexpression has been found to increase protein levels of SLC7A11, SLC40A1, and GPX4, while decreasing levels of COX2 and transferrin [PMC9674662]. In PC patients, LINC00976 is significantly overexpressed and correlates with clinical pathology features [PMC6868788].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGCUUCUUGCUGCCAACAUGUGAAGAAAGACGUGUUUGCUUCCCCUUCCACCAUGAUUGUAAAAUCAACAAGGAAGGCGAUGAGCACAGCAGUGUGAAGCAAUGACAAGGAUGCCCUAAGCUCUAUGAAACUGCGAGAUAAACAUCUACCAGGUUGAUAUCAUAUCACUCAAAAGCAAAAUUUAUUCCUCAGGUCUCUUCACAGCGUGGCGCCUGGGUUCCAAGGGGAAUCAUCCCAAGAGAGAACCAGGGAGAAACUGUAUCCACCUGCAAGAUCUAACAUCAGAAGUCAUAUAGAACACCAUUCCCUACUCUUAGCUAAGGAAGUCACAGAGAUCUGACUCCCUUCCUUCAAGGGAGGGAACCAUAGACUCUACUUGUGGGACUGGCUGGGUUCUGAUAGAAUAUGGACAUAUGACUUCAGCCAUUUUUGGAAAUUAUACUGUGCCACACCUUAACGUGUCAGAAGACGAGGACACUGUCAUAACUUUCAGUCAAUUGCUCAAACCAAAUAUCAAAGUAUUAUCCUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications