v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 621 (LINC00621) URS0000A769F1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00621: LINC00621 is a long intergenic non-coding RNA (lincRNA) that is not well understood, and there is a lack of knowledge about both LINC00621 specifically and lincRNAs in general [PMC9601614]. In a specific case, Sanger sequencing revealed that the orientation of the two genes, SGCG and LINC00621, was opposite, and the breakpoint of an assumed inversion was narrowed down to a 19 bp sequence [PMC9601614]. AluY repeats were found in both areas of the long-distance reads upstream of LINC00621 and in intron 2 of SGCG [PMC9601614]. Whole genome analysis showed a homozygous inversion on chromosome 13 with a breakpoint downstream of LINC00621 and within intron 2 of SGCG [PMC9601614]. The presence of highly homologous AluY repeats in SGCG and LINC00621 explains the formation of the inversion [PMC9601614]. The effect on the patient's phenotype due to the breakpoint downstream of LINC00621 remains unclear [PMC9601614]. PCR analysis failed to amplify any products using specific primers for LINC00621 and SGCG in the patient, while products were detected in control samples [PMC9601614]. The sequence divergence marked in an electropherogram indicates where the sequence for LINC00621 ends and SGCG starts [PMC9601614]. Amplification analysis using cDNA revealed no product for both SGCG transcript and LINC00621 in the patient, while control samples showed products with expected sizes using specific primers [PMC9601614].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUACUAAAUCAGGAUCAGGACAACCAUUUGAACUGAGUAAACUAACAUAUCUACAUCCACAUCUGUGGGUCUCCUUUGCUUCUGGGCUACUCACUGGCAAAAGUCCUGAGCGGCUCUCACAAUAUCUGCUUUUCCAUCUUCCGGCAAUAGCACCUUCACUGCCAAAUGGCAAUUUAAAACUUGAUCAUCUUUGUCAUUACUAUUUGCAAACUCUGGUGAGCAUUUUGAACAAUCUAGGCCCAGAAGUUCUUGCUGUUGUUUUAAAAUUCCAUCCAUCAAUCUGGAAUUAUUUCUUUUGAAAAUACCUUGGUGGUCGUAGACGCUAAUGUAGGAGAUGCCCACGGCCAUACACCACACCACGAGGCUCUCGAUGUCCGAGAAGCUGGGUUCCUGCUCCACCUCGGUGAUCACCAGGCCCAUGUGCACAGGCAGCUUCUCCAGGGAAGGGCCGUCCGCGCGCCAGCGCACCUGGUGGUGGGCUGCGGGCAGGCACGACCCCCGGCGCGGGUGCGGGUGGUGAUGGCGGUUCCUGCAGACGCCUGGGACUUGCGGAGCGUGAAGCCGAGCGGCGCUAGGACCGCGGCAGAGGCGGCGCGCCGGCACAGUCGCCAGAUCCAGUUCCAAGUGCCGAACCGAACGCGGAGCCAGGAGCUACAGGAAUUUAGCCAAUUCAGAGGAAAUCUUCCCCAUAAUUAUGGAACUUUCUUACAGAUUUUACCAAGUCUGGUCAACCCAAUAAGAAAAAGACUGAAAUAACAACAACAACUUCAACAAAUAAAAAAAAACAGUUAAGCUAAAUAAACAGAUGAUUGCAGAAUUUAUGUGAUUACUGGGUACUCUAAUGGUAAGGAGAAAUUAAGACCAGCUAGUUGUUAAUCUUAACUUUUAGUCAUUAAGGAGAAUUUCCAAGACAAAACUGCAAUCCAGCUGCUUACCUAGGAAUACGGCUUAGGCUGAAAACUUCUAUCGUCUUAGAAAUGGGAAUAAACCUCACACUCACCGUCCCUGUUGGAAGCAAGCUGAAACUCCAAAAAAAAAGUUGCCUGUUGUCCAUCAUCAUGGUGAAGCGGCGUCGUUGUCUGGGAACCCAAUUGGAGACGUUGGAUAUUUUAUCAAGUCUUUGACUGGAAUGACAUUUUUUCAGAAAUAACCAGACUGCUUUGAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications