Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2783 (LINC02783) URS00009C6115_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02783: LINC02783, a long non-coding RNA (lncRNA) located on human chromosome 11p15.3, is highly expressed in patients with renal cell carcinoma (RCC) and is associated with a poor prognosis [PMC7555264]. Patients with high expression of LINC02783 had larger tumor size, advanced TNM stage, and higher risks of tumor metastasis [PMC7555264]. Knock-down of LINC02783 led to lower viability and invasion, as well as higher apoptosis in RCC cells [PMC7555264]. LINC02783 can regulate the biological function of RCC cells via the miR-20b/Sox-4 axis [PMC7555264]. The results of overall survival favored patients with low LINC02783 expression over patients with high expression [PMC7555264]. LINC02783 can target miR-20b and act as a sponge for miR-20b [PMC7555264]. The co-transfection of miR-20b-mimics, pcDNA-Sox-4, and si-LINC02783 reversed the suppression of RCC cell viability and invasion by si-LINC02783 [PMC7555264]. High Sox-4 expression in KIRC tissues was positively correlated with LINC02783 expression and led to a poor prognosis [PMC7555264]. The knock-down of LINC02783 can inhibit the growth of RCC cells through the miR-20b/Sox-4 axis [PMC7555264]. This study provides insights into the clinical value and underlying mechanism of LINC02783 in RCC, identifying it as a potential therapeutic target for treatment [PMC7555264].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGACAGCUCGACCGUGAUGGAGGAGACAGGCAUUUAGAAUAAGCAUGAAAUAAAGGUGGCUGUUAAGGGGUCAGCUCCCCUCACCAAAGUCACUUUUGAUUUACUUACAAAAGUUUUCUUAAGAUUUCUUCAGAACCCAGGUCAAAAGGCUGUGGCAGGAGGCCAGGCAGAUCACAGCGUCCAUGCCUAGAUGCUCCCUGACCCCCAGGAACCAGAAGUGCUGUCUCCUGAAGGCUCUGGAAACCCGGAAUCAGCCUACGAGGCACCAGGGCCACCUUGGAGGGUGGAAAUGAGGACCUCAGGCCCCAGAGGGCAUGCAGGCGAGGUGAAGUUCAGGAGAGGGGAAAGAACAUGGGCUGUGUGGCCUUGGACCAAUUGCUUGCCCUCUCUGGGCCUUCUUAUUGGUGACAGACAGACUGGUGACUUUCUGAGAGGAUCUAUGCAACCUCAGGCUCCUGCACCUGGGUUACAGGGUCUUCUGGAGGGGAAGAGAUGAGCAGCAAGGACAAUAGCAGUGCUCCCUUCCCGGGUCAGUUGCAAGGAUUAAGGAUGAUGUCUGCAAAGUGCUUAGUCAGAGCCGGCAUACGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications