Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FMR1 antisense RNA 1 (FMR1-AS1) URS00008121A2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FMR1-AS1: FMR1-AS1 is an antisense transcription that overlaps the CGG repeat region and is capable of translating lncRNA FMR4 [PMC6882276]. FMR1-AS1 can activate Toll-like receptor 7 (TLR7) and Toll-like receptor 8 (TLR8) through various stimuli such as viral ssRNA, imidazoquinoline compounds, guanosine analogs, synthetic small interfering RNAs (siRNAs), exosomal FMR1-AS1 lncRNA, microRNA let-7, ssRNAs derived from dead cells, and guanosine derivatives [PMC6882276]. TLR7 is mainly expressed in plasmacytoid DCs (pDCs) and B cells, while TLR8 is predominantly expressed in macrophages, monocytes, and cDCs [PMC6882276]. Activation of TLR7/8 via intratumoral agonist in a melanoma model induces the production of CCL2 to facilitate the infiltration of M1 macrophages, CD8+ T cells, and B cells [PMC6882276]. Toll-like receptor 9 (TLR9), which is dominantly expressed in pDCs and B cells, recognizes unmethylated CpG motifs of ssDNA to initiate innate immune responses by increasing proinflammatory cytokines and activating cytotoxic NK cells and CD8+ T cells [PMC6882276]. Cyclic GMP-AMP synthase (cGAS) acts as a cytosolic dsDNA sensor by converting GTP and ATP into cyclic GMP-AMP (cGAMP), which activates stimulator of interferon genes (STING) through the second messenger 2′3’-cGAMP. This leads to the translocation of STING from ER to Golgi to form a complex with TBK1 or IKK [PMC7677403]. Exosomal FMR1-AS1 has been shown to induce ESCC tumor growth in vivo [PMC6367809].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCUUCAAGUGGCCUGGGAGCGCGCGCAUGCGCGCUGCUGGGAACCGGCCGGGGUGCCGGGUCGAAAGACAGACGCGCGGGCCGGGCGUGCGCGGGCUUGGUGGAGGGCGGGAAGGCUGAAGGGCGGUGACAGGUCGCACUGCCUCGCGAGGGCCAGAACGCCCAUUUCUGCAGAGGUGCACUCAGUGGCGUGGGAAAUCAAAUGCAUCCGGUUAUCCCAGUUCGGCCUCUCUGGGAUUCCGCGGGAGGGGGUGUCUGGUCUGGUUUGGUUUGGUUUGGUUUGGUUUGGUUUGGUCCGGUUCAAAGUAGCGCAGUCUGACUGAGCGGGAGGUGGAGUGGAAGGCGAGAAUAGGGGUGAAGGAUUAGACAGAAGAAGACUUUGAACUAGGAACAGUGGCAACCAGGGUGACCCAGGCUUUUGUGACCCGUAGAGGCAGAAGGUGAGGCGUCUACGCCCUCUCUCACCAGAUUUUGGGCGGCCCUGUGGAGACACCCUGUGCCCUUUAAGGGACAUGGAUUGAGUCGGGAUCUCAAAAUGUGAGCCUUUCCUCAGACCCAGCUUUGACCCACGUACUCGCCUUUCCUCAACUCAUUUUCAUACUUUCACUUGACUAUAUAUUUUUUAAAAAUUGUGUUAAGCACUUGAGGUUCAUUUCUGCCCCUACUGUAUGUGCACCCUGUGCCAGAGGGUGGGGUGAACACGUGUGUAGCAGUCAUGCGUCCUGUCCACAGGGGCCGAUGCACCUCCUUGCAACCCUUUACAUUCCACUGUGAAACAAACCUCAACUUUUUCUUAUUCCUGUUUUUACACCGUGCUUAUAGCUGCCUUAAUCCAUGUUCCCUUCGGGAUGCUGGUAUCCAACUGAGAAGUUGACGGAGCAUCUAUCGUGUGCCAGACACUGUGCUAAGUGCUAACGAGAAAUCGGUGAGCAAAACAGAAAAGAAAAAAAAAGAAGAAACGACUGCCAGCAUUGAACUUAGUACCUAGCAAAGUAGGUGGACAUAAAUCAAAUUGUCAGACAAGUAAAUGAGUAGUUGCAGCUGUGAUAAGGGGUAUGAAGAAUAGGCGCUUCCAUGAUGGCGGAACAUGACCUAGUCUGGGGUGGAGAAGGGGAGAUGAUUCCAGCUGGAAUAUGGCAGGUGAGAGUUAACUAAUAGCACUGAGUUGGCAGAGGCAGGAUGACCUGCCCCAGGCAGGUGCCCCAGAAUGAGAGGAUGUUGCUGCUGGUGGAACUCCAGCUUUAAAGCGGUGGAUCUAGGGCCACAUUCCUCAAGGCCAUAGCAAACAGGAAAGACCUUUUGGACUAGGGUCUUUGGAGUAGUCACAUGAGGCCAAGAACCCAAUAGGGCUGAAAGAGAAUCUCAUCAUAGGCUGAAUGGGAGCAGAGCAUUAGCUGCAACUCCAAUGUAUUAUAGUAAAAGGGGACACAUUGAUUAGAAUGAUUAUACCCCUCCAAGUGUAAGCUGUUGUUCAAUUUACCCAGGGCUUAAAAAUAUGUCAACUCUUCACAACCAUUUUUACUACAAGCCACACUCAACCUGUGUUGUUCCCUGAACCUGUGAUGCACUUUCAUCCGUUCAUGUCUCUACACAUCCUUCCUGGGCCCCAUAGAGGCCCUGCACCUUAAGGUUUUCAGCUGGAUUCCUAUUAGCUAGUUAUUUUAUCUCAGGUACAGAGAGUUAACUUUGCUCCUCAAUUUUCAGCACAUUGUCAUAUCAGUCCCUACAGGGUCCUUGUUUACAUUAUUUUAUAGUGUUUAUAUUAUUUUUUCCUCAUCUUUCUCGAUCCCCACUCUCAUUCUUCUAGACACAAGCUGCAAUAUGUUCGAUAGAGAUCCUUGAUAAUUUAACACAGAUAAUGUUUUGUUUAUGCCUCUUGCAUUUACAGAGAUGGUAUUGGACUGUAAAUCUCUAUUUCCCACUGUUUUACUCAACAGUCUGUUUUUGAGCUAUACCCACAUUGCUGUGUGUACACCUAGUUUGCUACCGAGUAUGCCAGAAAUUUUAUUCAUACAUAUCCCUACUGAUCGGGCAUCUAGGUUACUGCCAACUCCCUGAAGUCAUACUGUGGUGAAAACCCUUGUGAAUGUCUUUACAAACCUUUGCCAGAACUUAUUUUGUGCUCUUGUAGAACUUUGUGCAUACCCUCUGCUUCCUCAUUACACUGCUUGGCAUAUAGCAGAGACUCAACAAAUGUUGAAUACCUCUACUAUGAUGGUUAGUGUACUAGAAUAAUUUAUUUAUAUUUCUGUUUUCCUUAUUGGAUUAUUAGUACCUUCCAGACAGGGCAAAUGUCUUUUCUAUCUUUGUGUCCCUGGCACAUUAAAAGUGGUUGAUUUCAAGGUAUGUUCAAUGAAUGAAUAAAUACUUAUCUUCACUGCCAGUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications