v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CCDC26 long non-coding RNA URS00008120D0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CCDC26: CCDC26 is a poorly investigated long non-coding RNA (lncRNA) that plays crucial roles in several cancer models, including pancreatic cancer, leukemia, and laryngeal squamous cell carcinoma [PMC8124016]. In thyroid cancer, the effect of CCDC26 on disease progression remains unclear [PMC8124016]. However, CCDC26 has been found to be highly expressed in acute myeloid leukemia (AML) and is associated with poor prognosis [PMC6676650]. In AML cells, CCDC26 amplification and upregulation have been shown to be involved in cell growth [PMC7844715]. Knockdown of CCDC26 has been found to decrease colony formation in cells [PMC8124016]. CCDC26 is also associated with drug resistance. Inhibition of the insulin-like growth factor 1 receptor (IGF-1R), which induces drug resistance through the apoptosis pathway, can reverse the drug resistance caused by CCDC26 knockout [PMC9485670]. Furthermore, CCDC26 has been identified as one of the notable genes in MCF7 cells and is associated with Malignant Glioma and Astrocytoma [PMC7758440]. The role of CCDC26 in glioma growth and migration is being investigated [PMC7844715]. In addition to its role in cancer, lncRNAs such as FOXD2-AS1, TNRC6C-AS1, DARS-AS1 have also been found to modulate gene expression through miRNA targeting in thyroid cancer models [PMC8022221]. Overall, further research is needed to fully understand the role of CCDC26 in various cancers and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUUGGUGUCUGGGAGGUCAUGAGGAAAGGCUUCACUGUUACUCUCAGGGUCAACCUGGUGUGAUGCACACACCAAUUCAGCAGCCAAGUUUAUCUAGGAUAUGUCAAUCUCACAAGUUAUAGAAACUUCCAAGAAGUAGCAACAGGACCCAGGAGCUCACAGCUGGGUUUUCACUUAAUCCUUGUACAGUGUUGCCUCAGCUUCUCAAAGUUUCUGGUGUUUAUGAAGAUCCAUAACAGCUGGCUGCAAACCCAACUCCUGAGAAUCAUUUCUGGGAGAAUGCCGAAGACUGCAUUUCAACUUCAAGAAUGGCCUUUUAAAGGACCAUGGGCUGUUUGAGGGGCCAACAUCAUUAACUGGAAGGCCUGAGGAGAGAAGACACAUAGUCAUGCUGACUAAACCAGAUCACCUAGAAUUACCAAAUGGAAAGAUUGUGCCUGCAGCCUGGCCUGUUGCCCACAGCGGUCUACCUGCCACACUGGGAAAGAUCGAGCAGAGACAGAGAAGAAAAGGAGGCUCCAUUUUUCAGGCUGCUCUCCCGCAGGCUCAUGUUUUGUGUUCAUGCCAGGCAGAGAACACAAAAUGUUCCAAUAAAUAAGUAUCAAAGGUUAGUGGUGAAAAUGAAGGAGGAGGAGGCAUUGCGUGAAAAACUAAACAUGCAAAAUAUUACACACAAAGAGAACCAAAAUGCAGGUUCACUGGAAAUGAUAGACAAUAUGUUAAAACAAGAGGAGAGAAGAGAGCUGAAAUAAUCAAAUGGAAACACACAAUUUAGGGCUAAGAUCUUGUUGUGUUCAGCCACAAAUGAUGGCCAGCAGUGAGGAAUCUGUGUGUUCUCCACACUCUUCGCUCCUGGGAAGUCAACUCACAUGGACCAUGAUAUCAAUAUCUGCUCCUUCCCCUAAUAUCUGUUUGACCUUGGGUCAGUUACUUAAACUUCCUAAGCCUUAGUUUCUUUGUCUGGAAAAUAGGGAUAGUUAUACCUACCACACAACCACUUUGUAAUGAAUAUGUUGGAAAUUAUAUGCAAAUUGGCUUCCGUUGGUGUUUGGAACAUAGUAGGUUUUUAACUGGAAUAUAAUAGCUACCAUUAUCAGUAUCAUCAUAUUAAUUUAUAUUUCCAUCUUCAGCCCUUAACCCAGGAUCUUCAGUAAAUGUUGAAUUCUCAAAUUUGUUAAAUUCACUUGUCUAUACUAAUAUUUUACUCUAGGUUUCUUAGAAUAUUCUAGAUAAUAUUAUUAUGUAGAAUAUGUUAUGUAAGCUUCAUCUUAUCUGUAAAUAUAGUUUUACUUUUUCCUUUCUAAUUUUUAUGUCGAUUACUUCUUUUUCUUGGCUUAUUGAAUUGGCUAGGAUUCCCGUACAGUGUUGAAUACGUGCAGCAAGACUGCACAUCUUGCCUUGUUCCUGGUCCCACAGAGAGAAUAUCCAGUACUUCACAAUAAGUAUGUGUUAAUUGUAGAUUUUAUUAGAUUGAGGAAGUUCCCUUUCCUUUCAAGUCAGUCUUUUUAUUUUAAACAUGUAUUGAAGUUUUGUCAAAUGUCUUCAUCUAUUGGAAUAAUUAUACAUAUCUCUUUUUUAUUCUGUUAAUAUUACAUUUCAAUCUUCUGUCUACCUAAAAUCCCUAGAAUAAUCUCCAUUUGGCUAUGAUGUGUUGUGCUUUUAUAUAUUACUGAAUUCUAUAUGCCAAUAUUAUUAAAAUUUUCUGUCUUUAUGAGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications