v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ST7 overlapping transcript 3 (ST7-OT3) URS00007E482A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ST7-OT3: ST7-OT3 is a long non-coding RNA (lncRNA) that has multiple conserved RNA-domains [PMC4378963]. Among the lncRNA-associated Rfam models, 12 were found to be expressed, including ST7-OT3 [PMC4378963]. ST7-OT3, along with other lncRNAs such as CECR3, DHRS4-AS1, C22orf34, RAMP2-AS1, and PNCT_HSA157732, may be involved in immunological activity, growth factor binding, vascular proliferation, apoptosis, and steroid biosynthesis in the uterus to prepare the endometrium for embryo implantation [PMC6097487]. In patients with better endometrial receptivity, the expression of ST7-OT3 was down-regulated [PMC6097487]. The chromosome region 7q31.1-7q31.31 contains several genes including ST7 and its associated lncRNAs such as ST7-AS1 and ST7-AS2 [PMC5696175]. In a study comparing endometrial samples from patients with recurrent miscarriage (RM) and control group with successful conception using RT-PCR experiments, it was found that the expression of lncRNAs CECR3, ST7-OT3 (also known as NONHSAT212577.1), DHRS4-AS1 (also known as NONHSAT035952.2), C22orf34 (also known as NONHSAT193031.1), RAMP2-AS1 (also known as NONHSAT053761.2), and PNCT_HSA157732 (also known as NONHSAT025064.2) were significantly increased in RM patients' endometrium [PMC9515028].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGUAUUCAGAGACGUAGAGUGGCACAGCUCCUCAGACUGCACGUUUUCCCUGAGCUCUCUACUGGAAAACAUUUCUAUAAAACAUAAGAUGGCAAAGAGGUGGAAGAAAAAUUAAUGCCAGCAGUUCAGCUUUGACUAAAUAUAAGCUUACCAAAGUCAGCAACAAUAUGCUACACAGCUGCUUUGCUCAAAGCAAGAGCUGUCUCUGACAAAUCGCCAGUACCUACUGCAACAUCUUUUCUCCCUACACAGCGACUCCAGCUUGGGAGGGCAGGGCCAGGGUUGUCACAGCUUCCCCUGUGGUGUCUGCCUGCCAAGCACAGCUCUGGAGUUAGCCCUGGGUGUGAGAUUCUCUCCUGAGGCUGCAUCUCGGCGGGGGCUGAGCACAGCAGAGAUGAAUGCAGUAGAGGCCAUUCAUAGAGCUGUGGAAUUCAAUCCUCAUGUGCCAAAAUAUCUACAUGCUGUAUUACGUAAUUAUCAUCUUCUCUGAGGGAGGAAAAAAAGUAGCUGAGAGCCACUUUCAGUCCCGCUAUUAAGUACAUUUUGGCCUCUAAGAAACUUCGUGUGGUUCACCUCAGGCUAGGUGGAAAUAGAGGCUGCCUAGAAACAUGCAUUAACAGGUGCUUCUUGGGCCACCCUAGCCUGAAGAAGGACAACCAGAGAGUAUAACAGUGGCACCUCAAUGCCUUGGCCUUGAGGACCCUCAGUGUCCCUUCAGGCCUCCAGAUUUGAGGGGAGGCUCUAGCAUGUUCUGGCUGCAGCUAUUGUCUUCAGGGAUUCUGCAGCUUGUAGCUGCUUGGGGUACUUCUACCAAUUGGAGCUGGGCUGUUGGAGUCAUCUCCACUGCCUACCACCAGGACAAGCAGAGAAGUUACCUACUAGAAAUGAAAAGCUUAAUCCUACCCCCAGAACAUAUCCUGAAGAGAGGAGACAGUGAAGCAAUAGCAUAUGCAUUCUUUCAUCUUGCACACUGGAAGAGAGUGGAAGGGGCUUUGAAUCUUUUGCAUUGUACGUGGGAAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications