v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Sus scrofa (pig) microRNA ssc-mir-671 precursor secondary structure diagram

Sus scrofa (pig) microRNA ssc-mir-671 precursor URS00007E4287_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGGAAGAGGAGGAAGCCCUGGAGGGGCUGGAGGUGAUGGAUGUUUUCCUCCGGUUCUCAGGGCUCCACCUUUUCCGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Capra hircus miRNA (ENSCHIG00010008272.1)
  2. Catagonus wagneri microRNA 671 (ENSCWAG00000020088.1)
  3. Cervus hanglu yarkandensis microRNA 671 (ENSCHYG00000025767.1)
  4. Delphinapterus leucas microRNA 671 (ENSDLEG00000016895.1)
  5. Monodon monoceros (narwhal) microRNA 671 (ENSMMNG00015011259.1)
  6. Moschus moschiferus (Siberian musk deer) microRNA 671 (ENSMMSG00000009895.1)
  7. Phocoena sinus microRNA 671 (ENSPSNG00000005269.1)
 2D structure Publications