Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4539 URS00007E3F78_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4539: Hsa-mir-4539 is a miRNA that has been identified in various studies and is associated with different biological pathways and diseases. In one study, hsa-mir-4539 was found to be one of the 11 miRNAs that were in common among different conditions [PMC9252828]. Another study found that hsa-mir-4539 was related to the "C-type lectin receptor signaling pathway" and "viral carcinogenesis" [PMC8544760]. Additionally, hsa-mir-4539 was identified as one of the miRNAs that could discriminate between different pancreatic diseases [PMC7590436]. In the context of cancer, hsa-mir-4539 has been suggested as a potential therapeutic for the regulation of ABCB1, a gene associated with drug resistance [PMC7005303]. Furthermore, hsa-mir-4539 has been identified as an important discriminator for both colon and rectal cancer [PMC4822091]. Lastly, in non-small cell lung cancer patients, hsa-mir-4539 was found to be significantly correlated with overall survival [PMC8281680]. These findings highlight the potential role of hsa-mir-4539 in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGAACUGGGCUGAGCUGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications