Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MIR217 host gene (MIR217HG) URS00007E3EB3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR217HG: MIR217HG is a long non-coding RNA (lncRNA) that encodes miR-216a, miR-216b, and miR-217, which are highly expressed in pancreatic acinar cells [PMC9978013]. A study in mice aimed to determine the functional role of these miRNAs by deleting a 27.9 kbp region of MIR217HG. However, this deletion resulted in embryonic lethality at around E9.5 [PMC6668398]. The MIR217HG cluster has attracted attention in pancreatic ductal adenocarcinoma (PDAC) research [PMC6668398]. The researchers investigated if deletion of one miRNA within the cluster would affect the expression of another miRNA [PMC6668398]. Germline miRNA knockout mice were generated to simplify the study, considering that MIR217HG is predominantly expressed in the pancreas [PMC6668398]. The location of MIR217HG is on chromosome 2p16.1 in humans and 11qA3.3 in mice [PMC6668398]. The cause(s) of embryonic lethality upon deletion are not fully understood but could involve simultaneous loss of all three miRNAs or functional loss of MIR217HG lncRNA [PMC6668398]. In a separate study, differential expression analysis revealed that several genes were significantly upregulated or downregulated upon infection at 4 days post-infection (dpi), including CCL7, HIST1H3PS1, RN7SL472P (upregulated), and DAPL1, MIR217HG (downregulated) [PMC9330524]. Furthermore, SIRT6 was found to inhibit the expression of the miR-216a-5p-216b-5p-217 cluster by affecting histone modifications on the promoter region of its host gene MIR217HG in macrophages [PMC9800730]. Additionally, the lncRNA TREX4039, which overlaps with AC011306 and MIR217HG, showed peak expression at week 1 or 2 in various species and was extinguished by week 5 [PMC6372947]. These findings support the notion that MIR217HG plays a role in the simultaneous regulation of miR-217, miR-216a, and miR-216b at the transcriptional level [PMC9229466].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACACUCUUAGCACCCUACAAGCAGGUAUGUGCUUACCAGCAAACUAAAGCAAAUGGAAAUUAAGAAGCAUGAUCACCACCAGCAAGGUGCUGCUGAACUAUAAGCCUUCAGAUGGUCAGAUAAAGUACCUGAUGCUGAAAAACAGGAAAUUGAAUCAUGUCUCCAAAAUGUGCCUUUUGUCAUGCACUGUUACAGCUAUAUUUCUUGCUCUUUAGGCCUUAAUGAUUGACAUGAUCUUGGAAAACAGGUAUGUAGCAAAACUCUCCUAGAAACCUGAAAGAUGUGGCAAGAAGAAAACAUGGAGCCUUUUCUGAACAAGCCUAUGAGAGAAGAAGAAUCACUUCAAUUUAUUAAGUGUGGAUUCUGGGGCUAAAGAACUUACCUACAACCACACAGCCAGCAAAUUACUGACCCAGCAUAUUCUGAACCCAGGUCUUUAUUCUUUCCAAAACUUCACAGCACCUUCCUCAGAGCAUCUCUACAUGAAAAUCUGUAUAAAGAAGUGAUCUGUGGUGUCGCCAUUUGUAUCAAAAUGGUAUCACAAACUUAUUUAAAAGGCUUCAUCUAAAAGUCUUCAGAGUUUUGGCCAGGGAAGAGCUCUAAUAUCACACAUUAAUAACCUUACCUUUGUAACAUGUAAAUUGUUUUUUGUUUUAACAUCUCAGUUUCAUUAAACUGAGACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications