Canis lupus familiaris (dog) microRNA cfa-mir-216a precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) microRNA cfa-mir-216a precursor URS00007E3D1E_9615

105 nucleotides
3 databases (Ensembl, miRBase, RefSeq)
Found in 1 other species
38 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GAUGGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUGUUCAUACAAUCCCCCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUAUCCUUGCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Canis lupus dingo (dingo) microRNA 216a (ENSCAFG00020026845.1)

Publications