Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4259 precursor URS00007E3AE8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4259: Hsa-mir-4259 is a microRNA that regulates several target genes, including PDGFRA, RAC1, IKBKG, XIAP, and PPM1D [PMC9318750]. It shares the same target seed sequences as hsa-mir-4259 and hsa-miR-4715-5p [PMC5374554]. Hsa-mir-4259 is predicted to target the SPRY4 gene and transcription regulation genes [PMC5374554]. It has been detected in saliva samples but has not been quantified in plasma samples [PMC9481579]. Hsa-mir-4259 was not validated in a study that quantified several miRNAs [PMC9481579]. The miRNAs that were successfully quantified in the study included hsa-miR-92a-3p, hsa-miR-486-5p, hsa-miR-29a-3p, miR-486-3p, miR1505p, miR320b, miR4833p and miR3423p. Hsa-mir4259 was not detected in this study [PMC9481579]. Hsa-mir4259 is one of the selected miRNAs identified by hub genes [PMC9851797]. The pre-miRNA loop of hsa-mir4259 forms an rG4 structure [PMC7723054]. It was also detected in untreated extracellular vesicles (EVs) but at very low levels and was absent from cells and treated EVs [PMC10138286].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUGGGCCCCUUGUGUCCUGAAUUGGGUGGGGGCUCUGAGUGGGGAAAGUGGGGGCCUAGGGGAGGUCACAGUUGGGUCUAGGGGUCAGGAGGGCCCAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications