v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PIK3CD antisense RNA 2 (PIK3CD-AS2) URS00007E3AB7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PIK3CD-AS2: PIK3CD-AS2 is a long non-coding RNA (lncRNA) that has been studied for its clinical and translational relevance in lung adenocarcinoma (LUAD) [PMC7067885]. To further investigate its role, researchers established 12 representative LUAD patient-derived tumor xenograft (PDTX) models, with six of them originating from p53 wild-type surgical samples [PMC7067885]. PIK3CD-AS2 has three transcripts, with the longest one being ENSG00000231789, which consists of three exons [PMC7067885].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUCUCCCUCCUUCCUGCCGUCCCCCGCCUGAGGGAGGGGAGCGGUGCAGCAGACAUCCGAGGGCAGCUGGGACCCCCUGACUCAGCCGACGGGUGAGUCAGGCUCCCUGCAGGCCACACCGGACCCCCCCAGGGCGGGGAUUUCCCCAAGAUGAGAAAUCAGCCACCGGAAGUCACGCCGGACCUUGGACGGGCAGACAGAGGCUGGGAGGAGUUCUGGGUGCAGAGCCCCCCAACCUGUGCUCUCAUCUCUUGCUCUGGGGUAAGCCAGUGGCCAUGCUAUAAGGACACUCAAGCCACCCUAUGAAGAAGCCCACAUGAAGAGGAACUGAGAUAUCUGGCCAACAGCCAGCCAGUCACUGAGCCUGCCAACCACGCUGUGGCAGGUACCUCCAGCCCCAGACACCUGCAGCCUCCACUGAAAGCUCAAUGGCAGCCUCAUGAGACCCUGGACCGGAACCACCCAACGAAGCGGCUCCUGUAUUCCUGAUUGACAGAAACUACGGGAUCAUAAAUGCUUGCUGUUCAGUCUGCCAAGUGUUGGCGUGAUUUGUUAAACAGCAACCAGUAACUAAUACGCCACCCAUGGCUGCCGCGUUCCUGCUGUGGGGCCAGCACUAUUCCAUGCUUAGAGGCUCCAUCAAUACCUGUGAUGGACUAAAUGGCACGGUGGCUCACACCUAUAAUCUCACCACUUUGGGAGGCCGAAGUGGGAAGAUUGCUUGAGCCCAGAAGUUGGAGACCAGCCUGGGCAACACAGCAAGACCCCUGUCUCUACCGAAAAUGAAAAAAAUUAGCUGGGCAUGGCAGUGUGCACUUGGGAGCUACUCAGGAGGCUGAAGCGGGAGGAUCACUUGAGCUCAGGAGUUCAAGGCUGCAUUGAGCUAUGAUGGCACCACUGCAGUCCAGCCUAGGAGACAGAGCUAGACCCUGUCUCUAAAAAUAAAUAAAUAAAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications