Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-125a URS00007E385F_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-125a: Cfa-mir-125a is a microRNA that was randomly selected for qRT-PCR verification along with eight other miRNAs [PMC7689213]. It is a member of the miR-125 family, which also includes cfa-miR-125b [PMC4049822]. In a study on Macrobrachium nipponense, cfa-mir-125a was identified as one of the three significant miRNAs in the androgenic gland [PMC7804246]. Furthermore, qPCR analysis revealed that cfa-mir-125a had the highest expression level in the androgenic gland [PMC5607309]. Integrated analysis of differentially expressed miRNAs and genes suggested that cfa-mir-125a, along with two other miRNAs (aca-miR-30b-5p and ame-miR-263b), may play a significant role in sex-differentiation and sex-determination in M. nipponense [PMC5607309]. In another study on dog pituitary samples, cfa-mir-125a was found to be one of the most abundant known miRNAs [PMC4768678]. It was also identified as a potential target gene for TNF, which is negatively correlated with miR-125a expression [PMC9558963]. Additionally, downregulation of cfa-mir-125a was observed in the spleen of Beagle puppies during an enhanced inflammatory response [PMC9558963]. Overall, these findings highlight the importance of cfa-mir-125a in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGAGACCCUUUAACCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Publications