Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1055 (LINC01055) URS00007E3780_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01055: LINC01055 is a long intergenic noncoding RNA (lncRNA) that has been identified as one of the eight immune-related lncRNAs associated with the prognosis of patients with colorectal cancer [PMC8832759]. Univariate Cox regression analysis revealed that LINC01055 is one of the eight immune-related lncRNAs positively correlated with poor prognosis in colorectal cancer [PMC8093825]. Additionally, high expression of LINC01055 was associated with a poorer prognosis for colorectal cancer patients [PMC8093825]. The expression levels of LINC01055 were significantly different between colorectal cancer tissues and normal tissues [PMC8093825]. Furthermore, high expression of LINC01055 was associated with a poorer prognosis in a prognostic prediction model for colorectal cancer [PMC7607722]. The protein-coding genes related to LINC01055 were found to be enriched in various biological processes and pathways [PMC7607722]. Additionally, a study found that the paternally inherited A allele at a specific SNP was associated with decreased systolic blood pressure as well as decreased expression of LINC01055 in testis [PMC6338666].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGUGCAGGCCCCCUGCACUGAUCCUGAGUGGCCACCUAGACCAGGGUGUCCAGAGGCUCGACUAUAGGGUUCCUUCUUCUCCACCAUGGCACUUCAGGCUCCCUUGGCACUUCUCUUUUGGGAAAAUAAAUUGCUUCUGGAUUAGACAUCUUUCUGUUGCUGUUGCUUGAGACAGGGUCUCACUCUGUCACCCAGGCUGGAGUGCAAUGGCACAAUCAUGAUUCACUGCAGCCUCGACUUACUGGACUCAAGUGAUCUUCCCGCCGCAGCCCCCGAGGUAGCUGGGACUACAGGGUCUUACUCUGUCACCCAGGCUGGAGUGCAGUGGCAUAAUCUUGGCUCACUGCAGCCCCAACAUCCCCGGCUCAAGCAAUCCUCCCGCCUCAGCCUCCUAAGUAGCUGGGACCACAGAAACCCAAACUGCAGAACAUGUUCAGUGAAGCAACCAGAGCUAAAUCAUUUGAAAUGCAUUAGCCAGUACUCGCCGCAAAUUAAUUUAACACCAGUCACAUGUGUCUGGGUGAUUUUCCCCUGAAAGGUGGCGUGAGUUGAUUGGACCCCAGGAGGAACGCUGCGCUGAAUGGCUCAAGAUUUACUACUAACCACACACUGCACAGAGAAGGCUGCGUGUUACCAAGGCCUCCAUGGAAUUAGGGGGAACUGCCAACAAACCAGUGCAGAGCCUGCAAAUGUCAGAUAGAAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications