v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) gastric cancer associated transcript 1 (GACAT1) URS00007E3549_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GACAT1: Of these lncRNAs, 9 molecules were upregulated and associated with poor prognosis, including TERC, LINC01234, CCAT1, XIST, GACAT1, WT1-AS, CCAT2, HOXA11-AS, and TSIX [1]. To verify whether GACAT1 functioned by targeting microRNA-875-3p, we first upregulated GACAT1 and then overexpressed microRNA-875-3p as well, and found that the effect of GACAT1 on cell proliferation in BCap-379 and MCF-7 cells was partially inhibited by microRNA-875-3p overexpression [2].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGUUUACAAUCCUUUAGCUAGACAGAAAAGUUAUCCAAGUCCCCACUCGAACCAGAAAGUCCAGCUGGCUUCACCUCUCAAUAGCCUGCCCAUCAGCUGUUCUGUUGCCCUGUAGCCUGCUCCAGAUUAUCAGUGAAAUCACCGCAGCCAGAGACCCUUUCUAGAGUCCAGAAACCUGGUCUGCUUCUCUGGGCUAAGCCUCCUUCUGAAGACACCGGAGGAAAAUCCCUAGCUUUGGCUUUUCCAGCGUCAAGAGCAGCCUUGCAUUCCUGUUCCGGAGCAGAAUUAGAACAAUUUGAUUCUGAAUACAUUUAAGAAUUAAAAAAAAACAAAAUAAUUUAAGGAAGCAGAUUUAAGUCAUAUCUCAGCCAAGAACACAGAGCUAGUAAGUGGCAGAUCCAGGACCAUGCCAGGAAGUGUGAUUUCAGGAUACAAGCUCUUAAGCAUUACAUUAGGCCGCCUCUCUUACGGAAUCAUCCAGUGUUCAAUCUCAAAAUACUUACUGGUGUUAAAACACAUCCUUCCUUCCAAUGCAUCCUCUUUAUCUUCACAGCCGCCCCUUUUAUGGAAUCAUCCAGCGUCCAAUCUCAAAAUACAUAUUGGUGUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications