Automated summary: This pre miRNA sequence is 61 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (RefSeq, FlyBase, miRBase, ENA). Drosophila melanogaster (fruit fly) microRNA dme-mir-1009 precursor sequence is a product of mir-1009 precurso, mir-1009 precursor, mir-1009 precursor RNA, 1009 precursor RNA, mir-1009, 1009 precursor RN, FBgn0262435, dme-mir-1009 precursor genes. Found in the fruit fly reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GUAAGUGUAAGACUUUCUUGAGUUACCCGCGAUGAGUAUCUCAAAAAUUGUUACAUUUCAG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.