v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila sechellia mir-1003 microRNA precursor family secondary structure diagram

Drosophila sechellia mir-1003 microRNA precursor family URS00007B747B_7238

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGGGUAUCUGGAUGUGGUUGGCUCUGGCGGUCCUCUCACAUUUACAUAUUCACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Drosophila melanogaster microRNA dme-mir-1003 precursor
  2. Drosophila simulans Dsi-Mir-1003_pre stem-loop
  3. Drosophila yakuba Dya-Mir-1003_pre stem-loop
 2D structure Publications