Automated summary: This pre miRNA sequence is 56 nucleotides long and is found in Drosophila melanogaster. Annotated by 6 databases (FlyBase, ENA, RefSeq, MirGeneDB, miRBase, Rfam). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-1003, RF03830). Drosophila melanogaster (fruit fly) microRNA dme-mir-1003 precursor sequence is a product of mir-1003 microRNA precursor family, dme-mir-1003 precursor, 1003 precursor RNA, 1003 microRNA precursor famil, 1003 precursor RN, mir-1003 precursor, mir-1003 precurso, mir-1003 precursor RNA, mir-1003, FBgn0262431, 1003 microRNA precursor family, 1003 genes. Found in the Drosophila melanogaster reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GUGGGUAUCUGGAUGUGGUUGGCUCUGGCGGUCCUCUCACAUUUACAUAUUCACAG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.