Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) microRNA dme-mir-1003 precursor URS00007B747B_7227

Automated summary: This pre miRNA sequence is 56 nucleotides long and is found in Drosophila melanogaster. Annotated by 6 databases (miRBase, FlyBase, MirGeneDB, RefSeq, Rfam, ENA). Matches 1 Rfam family (mir-1003, RF03830). Drosophila melanogaster (fruit fly) microRNA dme-mir-1003 precursor sequence is a product of mir-1003 precursor RNA, dme-mir-1003 precursor, 1003 precursor RNA, mir-1003 precurso, 1003, 1003 microRNA precursor famil, mir-1003 precursor, FBgn0262431, 1003 precursor RN, mir-1003 microRNA precursor family, 1003 microRNA precursor family, mir-1003 genes. Found in the fruit fly reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GUGGGUAUCUGGAUGUGGUUGGCUCUGGCGGUCCUCUCACAUUUACAUAUUCACAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Drosophila sechellia mir-1003 microRNA precursor family
    2. Drosophila simulans Dsi-Mir-1003_pre stem-loop
    3. Drosophila yakuba Dya-Mir-1003_pre stem-loop
    Publications New