Automated summary: This pre miRNA sequence is 103 nucleotides long and is found in Sorghum bicolor. Annotated by 3 databases (Ensembl Plants, ENA, miRBase). Sorghum bicolor miR169o stem-loop (sbi-MIR169o) sequence is a product of MIR169o precursor, MIR169o precurso, sbi-MIR169o precursor, MIR169o, ENSRNA049997137 genes. Found in the sorghum reference genome.
This sequence is found in {{ locations.length }} genome
Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
---|---|---|---|---|---|---|---|---|
Loading genome locations... | ||||||||
Failed to load data from server | ||||||||
No genome locations known | ||||||||
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AUAGCCAAGGAUGAUUUGCCUGUAGCAACCUCUGAGUGCUCCUGCUGCCAUGGCAGUCAGGAGCGCCAAGUGGGUGCUUCUCCGGGCAAAUCAUCUGGGCUAG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.