Automated summary: This pre miRNA sequence is 102 nucleotides long and is found in Sorghum bicolor. Annotated by 3 databases (ENA, Ensembl Plants, miRBase). Matches 1 Rfam family (MIR169_2, RF00645). Sorghum bicolor miR169b stem-loop (sbi-MIR169b) sequence is a product of ENSRNA049996830, MIR169b precursor, sbi-MIR169b precursor, MIR169b, MIR169b precurso genes. Found in the Sorghum bicolor reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CAGCCAAGGAUGACUUGCCGGAUAUGUGCAUGCAUAUGUUACAAGGCAGCAUAUGCACCCUGUUACAAGCCUGCCUGUUCUCCGGCAAGUUGUCCUUGGCUA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.