Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sorghum bicolor miR395e stem-loop (sbi-MIR395e) URS00007A7A8B_4558

Automated summary: This pre miRNA sequence is 105 nucleotides long and is found in Sorghum bicolor. Annotated by 3 databases (miRBase, Ensembl Plants, ENA). Matches 1 Rfam family (mir-395, RF00451). Sorghum bicolor miR395e stem-loop (sbi-MIR395e) sequence is a product of MIR395e precursor, MIR395e precurso, ENSRNA049996013, MIR395e, sbi-MIR395e precursor genes. Found in the sorghum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUUAGGUUUGGUGUCCCCGGGAGUUCUCUGCAAGCACUUCACGAGGCACUAUUUUGAGAGCUUUUGUGAAGUGUUUGGGGGAACUCUUGAUGCCACUAACCAUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    Publications New