Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Populus trichocarpa miR1444b stem-loop (ptc-MIR1444b, ptc-MIR1444c) URS00007A468A_3694

Automated summary: This pre miRNA sequence is 85 nucleotides long and is found in Populus trichocarpa. Annotated by 4 databases (Rfam, Ensembl Plants, ENA, miRBase). Described in 4 papers. Matches 1 Rfam family (MIR1444, RF00956). Populus trichocarpa miR1444b stem-loop (ptc-MIR1444b, ptc-MIR1444c) sequence is a product of ptc-MIR1444c precursor, MIR1444c precursor, MIR1444c, MIR1444c precurso, ENSRNA049998263 genes. Found in the black cottonwood reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUAUCCCUCGAAUAUUGAUCGAAUAUGUAUGAAAUAUGAUGGUUAAAUGUUUCAUUCACAUUCGGUCAACGUUCGAGUGAUAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    Publications New